Suillus neoalbidipes — The Life Data

Fungi/Basidiomycota/Agaricomycetes/Boletales/Suillaceae/Suillus

At a glance

Occurrence records40

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Suillus neoalbidipes's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility40 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF40 records

DNA & barcodingNCBIsequences

01Narrative

Suillus neoalbidipes is a species of edible mushroom in the genus Suillus. It was described as a new species by Mary Palm and Elwin Stewart in 1984.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Suillus neoalbidipes has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPZ354760.1 ↗332 bpUSA · 1960

ACGT

GAACGCACCTTGCGCTCCTCGGTGTTCCGAGGAGCATGCCTGTTTGAGTGTCAGTAAATTCTCAACCCCTCTCGATTTGTTTCGAGAGGG …

Suillus glandulosipes clone 4832 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS10

fungal barcode

08Occurrence & distribution

Record type40 records

Wild obs. + sensor9

Museum / vouchered31

Range

Area of Occupancy AOO116 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 1≤1 km 1≤10 km 4>10 km 2

8 georeferenced · 1 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 4≤1 km 4≤10 km 15>10 km 2

25 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence31

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Université de Montréal Biodiversity Centrelocation not on record	11
St. Paul, US	8
Ann Arbor, US	4
Bronx, US	2
Chicago, US	2
Vancouver, CA	1
TENN-Flocation not on record	1
CA	1
FLASlocation not on record	1

9 institutions · 31 of 31 vouchered records shown