Suillus decipiens

(Peck) Kuntze · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Boletales/Suillaceae/Suillus

At a glance

Occurrence records197

Data sources9

Biological traits0

DNA specimens2

eDNA detections143

Sources9 archives

Databases and archives Suillus decipiens's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility197 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI143 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF197 records

Environmental DNA3 datasets · 2 countries143 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceGoaT · NCBI≈63 Mbp

01Narrative

Suillus decipiens is an edible species of mushroom in the family Suillaceae. First described by Charles Horton Peck in 1889 as Boletinus decipiens, it was transferred to Suillus in 1898 by Otto Kuntze. The fungus is found in southeastern North America, with the northern limit of its range extending to New Jersey.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Suillus decipiens has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences10

eDNA detections143

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPX576905.1 ↗317 bpUSA · 2024

ACGT

GAACGCACCTTGCGCTCCTCGGTGTTCCGAGGAGCATGCCTGTTTGAGCGTCAGTAAATTCTCAACCCCTCTCGATTCACTTCGACCGGG …

Suillus decipiens isolate S. D. Russell iNat # 195803147 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Suillus decipiens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈62 784 544 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Suillus decipiens0.06 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness95.1% BUSCO

08Occurrence & distribution

Record type197 records

Wild obs. + sensor132

Museum / vouchered65

Range

Area of Occupancy AOO512 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 45≤1 km 13≤10 km 24>10 km 12

94 georeferenced · 38 without coordinates

Open the mapobservation + sensor132

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤1 km 2≤10 km 4>10 km 5

11 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence65

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	27
Durham, US	16
Chicago, US	9
FLASlocation not on record	3
Blacksburg, US	3
WTUlocation not on record	1
University of Tennessee at Chattanoogalocation not on record	1
TENN-Flocation not on record	1
PHlocation not on record	1
Colorado State Universitylocation not on record	1

10 institutions · 63 of 65 vouchered records shown · 2 without an institution code

09Environmental DNA143 detections

Where the DNA of Suillus decipiens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found143

Studies independent surveys3

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 143 detections have coordinates

Open the map2 countries0

Nearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.8 °C 27.6–27.8

Seasonal swing summer↔winter17.0 °C

Max temp (day)33.0 °C 32.4–33.0

Min temp (night)23.7 °C

Precipitation135 mm/mo

Air humidity61.6 % 61.6–62.0

Moisture balance-38.7 mm/mo

Vapour deficit1,426 Pa 1,376–1,426

Wind speed1.70 m/s 1.70–1.80

Cloud cover24.0 % 24.0–25.2

CHELSA 1981–2010, ~9 km grid, at location & month of 141 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)