Suillus cothurnatus

Singer · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Boletales/Suillaceae/Suillus

At a glance

Occurrence records218

Data sources9

Biological traits0

DNA specimens3

eDNA detections77

Sources9 archives

Databases and archives Suillus cothurnatus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility218 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI77 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF218 records

Environmental DNA5 datasets · 6 countries77 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceGoaT · NCBI34 Mbp

01Narrative

Suillus cothurnatus is a species of mushroom in the genus Suillus. Found in Malaysia, Brazil, and North America, it was first described scientifically by mycologist Rolf Singer in 1945.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Suillus cothurnatus has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences10

eDNA detections77

Countries6

The DNA barcodea real sequence read deposited for this species

ITSOL342387.1 ↗221 bpUSA · 2018

ACGT

CCGGGGCTTGGATCCTGGGGGCTGCCGGAGACCTGTTTTTCAGGACTCGGGCTCCTCTGAAATGCATCGGCTTGCGGTCGACTTTTCGAC …

Suillus cothurnatus voucher DUKE:0352599 internal transcribed spacer region, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Suillus cothurnatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size33 950 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Suillus cothurnatus0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

Completeness94.5% BUSCO

08Occurrence & distribution

Record type218 records

Wild obs. + sensor63

Museum / vouchered155

Range

Area of Occupancy AOO536 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 18≤1 km 12≤10 km 9>10 km 11

50 georeferenced · 13 without coordinates

Open the mapobservation + sensor63

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 2≤1 km 20≤10 km 25>10 km 6

53 georeferenced · 102 without coordinates

Open the institutions mapphysical evidence155

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durham, US	89
Blacksburg, US	16
Chicago, US	10
FLASlocation not on record	7
Bronx, US	6
WTUlocation not on record	4
ILLSlocation not on record	4
Bernard Price Institute for Palaeontological Researchlocation not on record	3
Colorado State Universitylocation not on record	2
US	1
Brisbane, AU	1
Denver, US	1
Logan, US	1
TENN-Flocation not on record	1
Zapopan, MX	1
Valdosta State Universitylocation not on record	1

16 institutions · 148 of 155 vouchered records shown · 7 without an institution code

09Environmental DNA77 detections

Where the DNA of Suillus cothurnatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found77

Studies independent surveys5

Countries6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 77 detections have coordinates

Open the map6 countries0

Nearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 8.60–27.8

Seasonal swing summer↔winter13.1 °C

Max temp (day)21.2 °C 15.6–33.0

Min temp (night)11.7 °C 2.60–23.7

Precipitation96.6 mm/mo 14.9–230

Air humidity61.6 % 47.2–66.3

Moisture balance-38.7 mm/mo -58.8–112

Vapour deficit743 Pa 592–1,426

Wind speed2.60 m/s 1.60–3.50

Cloud cover34.1 % 24.0–50.1

CHELSA 1981–2010, ~9 km grid, at location & month of 74 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)