Suillus cavipes

(Klotzsch) A.H.Sm. & Thiers · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Boletales/Suillaceae/Suillus

At a glance

Occurrence records2 969

Data sources11

Biological traits0

DNA specimens14

eDNA detections116

Sources11 archives

Databases and archives Suillus cavipes's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 969 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI116 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.05 Gbp↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS72 compounds

Occurrence & distributionGBIF2 969 records

Environmental DNA5 datasets · 8 countries116 detections

DNA & barcodingBOLD · NCBI14 specimens

Genome at a glanceGoaT45 Mbp

01Narrative

Suillus cavipes is an edible species of mushroom in the genus Suillus. It is found in Europe and North America. It is associated with larch in the Pacific Northwest. The brownish cap is dry, scaly, sometimes with veil remnants on the edge. The pores are buff. The stipe is yellowish above, sometimes with a slight ring, and cap-colored below; it is hollow, hence the epithet cavipes (Latin: 'hollow foot').

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition72 compounds

Compounds documented for Suillus cavipes across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Phytane diterpenoids58

Steroidal alkaloids15

Acyclic monoterpenoids $ Farnesane sesquiterpenoids3

Steroidal alkaloids $ Terpenoid alkaloids1

Documented compounds72 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2R,6R,9S,10R,11R,14S,15S,17R,18S,20S,23R,24S)-6,10,23-trimethyl-4-azahexacyclo[12.11.0.02,11.04,9.015,24.018,23]pentacosane-17,20-diol	present	NPASS
(1R,2R,6S,8R,9R,11S,14S,15S,18S,20S,23R,24R)-8,20-dihydroxy-6,8,23-trimethyl-4-azahexacyclo[12.11.0.02,11.04,9.015,24.018,23]pentacosan-17-one	present	NPASS
(1R,2R,6S,8S,9R,11R,14S,15S,17R,18S,20S,23R,24S)-6,8,23-trimethyl-4-azahexacyclo[12.11.0.02,11.04,9.015,24.018,23]pentacosane-17,20-diol	present	NPASS
(1R,2R,6S,8S,9R,11R,14S,15S,18S,20S,23R,24S)-20-hydroxy-6,8,23-trimethyl-4-azahexacyclo[12.11.0.02,11.04,9.015,24.018,23]pentacosan-17-one	present	NPASS
(1R,2S,6S,9S,10R,11S,12S,14S,15S,17R,18S,20S,23R,24S)-6,10,23-trimethyl-4-azahexacyclo[12.11.0.02,11.04,9.015,24.018,23]pentacosane-12,17,20-triol	present	NPASS
(1R,2S,6S,9S,10S,11S,14S,15S,17S,18S,20R,23R,24S)-6,10,23-Trimethyl-4-azahexacyclo[12.11.0.02,11.04,9.015,24.018,23]pentacosane-10,17,20-triol	present	NPASS
(1R,6R,9S,10R,14S,15S,17R,18S,20S,23R,24S)-6,10,23-trimethyl-4-azahexacyclo[12.11.0.02,11.04,9.015,24.018,23]pentacos-2(11)-ene-17,20-diol	present	NPASS
(2E,6E,10E,14E)-16-hydroxy-2,6,10,14-tetramethylhexadeca-2,6,10,14-tetraenoic acid	present	LOTUS
(2E,6R,10E,14E)-3,11,15-trimethyl-7-methylidenehexadeca-2,10,14-triene-1,6,16-triol	present	LOTUS
(2E,6S,7E,10E,14E)-2,6,10,14-tetramethylhexadeca-2,7,10,14-tetraene-1,6,16-triol	present	LOTUS

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Suillus cavipes has left across the world's sequence archives.

At a glance

DNA specimens14

Marker genes3

GenBank sequences10

eDNA detections116

Countries8

The DNA barcodea real sequence read deposited for this species

ITSAB284452.1 ↗604 bpJapan · 2004

ACGT

AAGAATTTATAATCCGGCGAAAGGGGGANGGGGGAAGCTGTCGCTGGCCTTTCGCGAGGCATGTGCACGCTTTCTTCTGAACCCTCAGCC …

Boletinus cavipes IKE41.2 genes for ITS1, 5.8S rRNA, ITS2, partial and complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10★ITS1

animal barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Suillus cavipes carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size45 390 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Suillus cavipes0.05 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type2 969 records

Wild obs. + sensor2 474

Museum / vouchered495

Range

Area of Occupancy AOO5 824 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 1 185≤1 km 239≤10 km 790>10 km 25

2 239 georeferenced · 235 without coordinates

Open the mapobservation + sensor2 474

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 40≤1 km 95≤10 km 72>10 km 16

223 georeferenced · 272 without coordinates

Open the institutions mapphysical evidence495

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ann Arbor, US	52
WTUlocation not on record	31
Olocation not on record	27
Toronto, CA	26
Göteborg, SE	24
Bronx, US	23
Helsinki, FI	21
Copenhagen, DK	20
SLU Artdatabankenlocation not on record	20
Pullman, US	14
Acadia Universitylocation not on record	12
Université de Montréal Biodiversity Centrelocation not on record	11
St. Paul, US	10
Chicago, US	9
Cincinnati, US	8
Kew, GB	7
Durham, US	6
ILLSlocation not on record	6
Karlsruhe, DE	6
IB FRC Komi SC UB RASlocation not on record	5
TENN-Flocation not on record	5
Uppsala, SE	4
TUR-Alocation not on record	4
Denver, US	3
Vancouver, CA	2
Mlocation not on record	2
Catholic University of Pekinglocation not on record	2
LDlocation not on record	2
CA	2
DPIlocation not on record	2
Trondheim, NO	2
Royal Ontario Museum, TRTC Fungariumlocation not on record	1
Slovenian Forestry Institutelocation not on record	1
MeiseBGlocation not on record	1
Philadelphia, US	1
Stockholm, SE	1
Oulu, FI	1
GJOlocation not on record	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1
Jyväskylä, FI	1

40 institutions · 377 of 495 vouchered records shown · 116 without an institution code

09Environmental DNA116 detections

Where the DNA of Suillus cavipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found116

Studies independent surveys5

Countries8

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 116 detections have coordinates

Open the map8 countries0

Palearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH5.40 4.20–8.70

Conductivity49.0 µS/cm 14.0–409

Organic carbon3.17 % 0.19–5.55

Water content22.5 % 3.86–79.2

Nitrate-N4.00 mg/kg 1.00–20.0

Phosphorus27.0 mg/kg 4.00–100

Clay15.8 % 1.94–39.2

Sand66.3 % 43.3–96.1

Depth0 m 0–0.2

SoilTenosolsChromosolsKandosolLatLon out of rangeRudosol

36 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.00 °C 1.70–13.9

Seasonal swing summer↔winter20.6 °C

Max temp (day)9.10 °C 3.60–18.0

Min temp (night)1.00 °C -0.5–8.40

Precipitation108 mm/mo 91.3–236

Air humidity64.2 % 58.3–66.0

Moisture balance57.2 mm/mo 34.9–116

Vapour deficit311 Pa 235–660

Wind speed2.70 m/s 1.50–5.20

Cloud cover40.7 % 17.4–54.8

CHELSA 1981–2010, ~9 km grid, at location & month of 109 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Suillus cavipes

At a glance

Sources11 archives

Compound class profile4 classes

Documented compounds72 total

At a glance

Genome sizehow big the whole instruction manual is

Record type2 969 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions22 of 40 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type2 969 records