Suillus brunnescens

A.H.Sm. & Thiers · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Boletales/Suillaceae/Suillus

At a glance

Occurrence records38

Data sources8

Biological traits0

DNA specimens1

eDNA detections15

Sources8 archives

Databases and archives Suillus brunnescens's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility38 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF38 records

Environmental DNA3 datasets · 11 countries15 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Suillus brunnescens is a species of bolete fungus in the family Suillaceae. It was first described scientifically by American mycologists Alexander H. Smith and Harry D. Thiers in 1964.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Suillus brunnescens has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences5

eDNA detections15

Countries11

The DNA barcodea real sequence read deposited for this species

ITSOP215196.1 ↗587 bpKazakhstan · 2021

ACGT

GGAGGGTTGTAGCTGGCCTCTAGGGGCATGTGCACGCTCTCTTCCGGACCTTTCGCCGTATGGGCGCGGGGCGACCCGCGTCTTCATATA …

Suillus brunnescens isolate sbfungi34 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5

fungal barcode

08Occurrence & distribution

Record type38 records

Wild obs. + sensor12

Museum / vouchered26

Range

Area of Occupancy AOO116 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 6≤10 km 2>10 km 2

10 georeferenced · 2 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 1≤10 km 3

4 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence26

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	3
WTUlocation not on record	3
Pullman, US	2
St. Paul, US	2
Bernard Price Institute for Palaeontological Researchlocation not on record	1
California State University, East Baylocation not on record	1

6 institutions · 12 of 26 vouchered records shown · 14 without an institution code

09Environmental DNA15 detections

Where the DNA of Suillus brunnescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys3

Countries11

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map11 countries0

ForestIndomalayanPalearcticNeotropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median4.90 °C -3.20–15.6

Seasonal swing summer↔winter17.1 °C

Max temp (day)8.90 °C -1.30–19.6

Min temp (night)0.9 °C -7.70–10.2

Precipitation112 mm/mo 44.3–313

Air humidity64.3 % 59.0–70.8

Moisture balance25.9 mm/mo -6.00–225

Vapour deficit362 Pa 213–632

Wind speed2.70 m/s 1.90–4.10

Cloud cover45.9 % 35.9–58.5

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)