Suillellus mendax

(Simonini & Vizzini) Vizzini, Simonini & Gelardi · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Boletales/Boletaceae/Suillellus

At a glance

Occurrence records239

Data sources8

Biological traits0

DNA specimens0

eDNA detections14

Sources8 archives

Databases and archives Suillellus mendax's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility239 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF239 records

Environmental DNA5 datasets · 5 countries14 detections

DNA & barcodingNCBIsequences

01Narrative

Suillellus mendax is a species of bolete fungus found in Europe. It was originally published as a species of Boletus when it was newly described in 2013, but then transferred to Suillellus the following year. This species is morphologically very similar to the widespread Suillellus luridus, but differs in its predominantly acidophilous ecology, a mostly dull-coloured, finely felty cap and more narrowly ellipsoid to subfusiform spores measuring (12.4–)13.3–14.7(–15.5) × (4.5–)4.9– 5.5(–5.7) μm. Suillellus mendax forms ectomycorrhizal associations with beech (Fagus), oak (Quercus) and sweet chestnut (Castanea). So far, it has been molecularly verified from Italy, France and the island of Cyprus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Suillellus mendax has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

eDNA detections14

Countries5

The DNA barcodea real sequence read deposited for this species

ITSPZ193245.1 ↗328 bpSpain · 2016

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAATTCTGGAGGGGTGGGCAACGCGGCCGAGTCAGAGACTGTCGCTGGCCCCTTGG …

Suillellus mendax voucher LUGO_ECC16100702 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type239 records

Wild obs. + sensor191

Museum / vouchered48

Range

Area of Occupancy AOO700 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 80≤1 km 35≤10 km 18>10 km 6

139 georeferenced · 52 without coordinates

Open the mapobservation + sensor191

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 4≤1 km 8≤10 km 1

13 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence48

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WU-MYClocation not on record	20
LDlocation not on record	4
Copenhagen, DK	4
TUR-Alocation not on record	3
Kew, GB	3
Karlsruhe, DE	3
SLU Artdatabankenlocation not on record	3
Philadelphia, US	2
Provincia di Livornolocation not on record	1
Swiss Federal Institute for Forest, Snow and Landscape Researchlocation not on record	1

10 institutions · 44 of 48 vouchered records shown · 4 without an institution code

09Environmental DNA14 detections

Where the DNA of Suillellus mendax was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys5

Countries5

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map5 countries0

Palearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.60 °C 4.80–24.6

Seasonal swing summer↔winter19.6 °C

Max temp (day)11.2 °C 6.90–30.0

Min temp (night)5.80 °C -0.5–18.4

Precipitation86.3 mm/mo 43.8–242

Air humidity57.9 % 52.5–62.2

Moisture balance24.2 mm/mo -108–130

Vapour deficit500 Pa 291–1,470

Wind speed3.50 m/s 2.40–5.00

Cloud cover32.8 % 30.4–40.5

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)