Suberites domuncula

(Olivi, 1792) · species

image placeholder — illustration coming later

Animalia/Porifera/Demospongiae/Suberitida/Suberitidae/Suberites

At a glance

Occurrence records1 747

Data sources11

Biological traits6

DNA specimens14

eDNA detections271

Sources11 archives

Databases and archives Suberites domuncula's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility880 records↗

OBISOcean Biodiversity Information System867 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI271 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~1.56 Gbp↗

Catalogue of LifeCOLtaxonomy↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Chemical compositionLOTUS · NPASS31 compounds

Occurrence & distributionGBIF · OBIS1 747 records

Environmental DNA4 datasets · 2 countries271 detections

DNA & barcodingBOLD14 specimens

Genome at a glanceGoaT1.6 Gbp

01Narrative

Suberites domuncula is a species of sea sponge belonging to the family Suberitidae. This species contains suberitine, a neurotoxin that can cause fatal hemolytic hemorrhaging in various animals. While it is highly toxic to fish, it is known to be preyed upon by the hawksbill turtle, Eretmochelys imbricata. There are currently two accepted subspecies of this taxon: Suberites domuncula domuncula and S. domuncula latus. In 1893, Lambe described a new sponge species as Suberites latus. This was later determined to be a junior synonym of S. domuncula and merged into the species as a subspecies under the scientific name S. domuncula latus. S. domuncula is well known for colonizing gastropod shells occupied by hermit crabs. At least 13 species of hermit crabs have been found associated with this sponge. It has also been recorded attached to the shells of live gastropods and the carapace of other crustaceans.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length10 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

Other traits3

Depth max1 100 m

Depth min0 m

Vulnerability10

03Chemical composition31 compounds

Compounds documented for Suberites domuncula across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cyclic peptides7

Plant xanthones6

Friedelane triterpenoids3

Pyrrolidine alkaloids2

Pyranocoumarins2

Documented compounds31 total

Tissue Source Quantified only

Compound	Amount	Source
(10R,11R)-10,11,16,16-tetramethyl-6-phenyl-3,9,15-trioxatetracyclo[12.4.0.02,7.08,13]octadeca-1,5,7,13,17-pentaene-4,12-dione	present	NPASS
(10S,11S)-10,11,16,16-tetramethyl-6-propyl-3,9,15-trioxatetracyclo[12.4.0.02,7.08,13]octadeca-1,5,7,13,17-pentaene-4,12-dione	present	NPASS
(2S,3S)-5-hydroxy-2,3,8,8-tetramethyl-6-(1-phenylethenyl)-2,3-dihydropyrano[2,3-h]chromen-4-one	present	NPASS
(3S,5S,8R,9S,10S,13R,14S,17R)-17-[(E,2R,5S)-5,6-dimethylhept-3-en-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	LOTUS
(3S,7R,8aS)-7-hydroxy-3-methylhexahydropyrrolo[1,2-a]pyrazine-1,4-dione	present	LOTUS
1,5-Dihydroxyxanthone	present	NPASS
2-(3-Methylbut-2-enyl)-1,3,5-trihydroxyxanthone	present	NPASS
6,8-Dihydroxy-1,1-bis(3-methylbut-2-enyl)-3,4-dihydroxanthene-2,9-dione	present	NPASS
6-Deoxyjacareubin	present	NPASS
Betulinic Acid	present	NPASS

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Suberites domuncula has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes12

eDNA detections271

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P619 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.43%

Haplotypes2

BIN1

Most divergent pair0.65%

Where individuals differ — all 4 variable positions, in barcode order

4Cvariable

14Avariable

62Tvariable

584Gvariable

GGGCTTTTGCCGGAATGATAGGGACAGCTTTTAGCATGTTAATAAGATTAGAGCTATCTGCTCCTGGTTCAATGCTTGGCGATGACCATT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Halichondria paniceasame order7.8%Hymeniacidon heliophilasame order8.0%Hymeniacidon perlevissame order8.2%Halichondria sitienssame order8.5%Axinyssa topsentisame order8.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcoderibosomalmitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_010496 ↗ · 14 protein · 25 tRNA · 2 rRNA

COX2ATP8ATP6COX3CYTBATP9ND4ND6ND3ND4LCOX1ND1ND2ND5rnlrns

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT

The complete instruction manual Suberites domuncula carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 564 800 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Suberites domuncula1.56 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

07Deep time~0 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin0 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type1 747 records

Wild obs. + sensor600

Museum / vouchered465

Other682

Origin

Native4

Range

Area of Occupancy AOO2 512 km²

Depth

0–200 m sunlit744

200–1000 m twilight35

1–4 km midnight0

>4 km abyssal0

median 63.3 m · max 714.8 m · 779 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 54≤1 km 495≤10 km 5

554 georeferenced · 46 without coordinates

Open the mapobservation + sensor600

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 13≤1 km 30≤10 km 7>10 km 3

53 georeferenced · 412 without coordinates

Open the institutions mapphysical evidence465

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ICATMARlocation not on record	32
DASSHlocation not on record	16
Frankfurt am Main	15
Victoria, CA	10
CASlocation not on record	10
AUTHlocation not on record	9
PNHSlocation not on record	9
South Kensington, GB	8
Cambridge, US	5
Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record	3
IEO-COMA-CSIClocation not on record	2
Barcelona, ES	2
Washington, US	2
UB_ICMlocation not on record	2
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
ARMS-MBONlocation not on record	1
WoRMS Editorial Boardlocation not on record	1
Laboratoria di biologia marina di Triestelocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
MZLUlocation not on record	1

20 institutions · 131 of 465 vouchered records shown · 107 without an institution code

09Environmental DNA271 detections

Where the DNA of Suberites domuncula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found271

Studies independent surveys4

Countries2

Verifiable raw sequence linked270

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 271 detections have coordinates

Open the map2 countries0

Marina; semi-industrial; 9.5 - Subtidal Sand…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.60 °C -5.30–17.2

Seasonal swing summer↔winter23.4 °C

Max temp (day)12.6 °C -1.40–21.1

Min temp (night)6.60 °C -8.90–15.0

Precipitation110 mm/mo 94.3–130

Air humidity61.4 % 60.3–65.0

Moisture balance38.8 mm/mo -35.9–91.8

Vapour deficit457 Pa 165–689

Wind speed4.60 m/s 1.80–6.00

Cloud cover54.1 % 48.7–65.9

CHELSA 1981–2010, ~9 km grid, at location & month of 270 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Suberites domuncula

At a glance

Sources11 archives

Size & morphology1

Habitat & environment2

Other traits3

Compound class profile5 classes

Documented compounds31 total

At a glance

Genome sizehow big the whole instruction manual is

At a glance

When this lineage existed

Record type1 747 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 747 records