Subclytia rotundiventris

(Fallén, 1820) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Subclytia

At a glance

Occurrence records730

Data sources7

Biological traits0

DNA specimens13

eDNA detections43

Sources7 archives

Databases and archives Subclytia rotundiventris's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility730 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI43 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF730 records

Environmental DNA3 datasets · 5 countries43 detections

DNA & barcodingBOLD13 specimens

01Narrative

Subclytia rotundiventris is a European species of fly in the family Tachinidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Subclytia rotundiventris has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections43

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.02%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

406Cmostly conserved

AACTTTGTATTTTATTTTTGGGGCATGATCTGGAATAGTAGGAACTTCTTTAAGTATTTTAATTCGAACTGAATTAGGTCATCCTGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ectophasia rotundiventrissame family7.7%Gymnosoma rotundatumsame family8.1%Gymnosoma nudifronssame family8.1%Gymnosoma costatumsame family8.1%Ectophasia crassipennissame family8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_050880 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type730 records

Wild obs. + sensor651

Museum / vouchered79

Range

Area of Occupancy AOO2 020 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 243≤1 km 152≤10 km 210>10 km 5

610 georeferenced · 41 without coordinates

Open the mapobservation + sensor651

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 36≤1 km 30≤10 km 5>10 km 1

72 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence79

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	20
University of Tokyo, Department of Zoologylocation not on record	11
NEFlocation not on record	4
NHMOlocation not on record	4
Helsinki, FI	3
South Kensington, GB	2
Iwate Prefectural Museumlocation not on record	1
Metsähallituslocation not on record	1
neflocation not on record	1
Copenhagen, DK	1

10 institutions · 48 of 79 vouchered records shown · 31 without an institution code

09Environmental DNA43 detections

Where the DNA of Subclytia rotundiventris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found43

Studies independent surveys3

Countries5

Verifiable raw sequence linked31

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 43 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 13.5–17.2

Seasonal swing summer↔winter18.0 °C

Max temp (day)20.0 °C 16.4–20.9

Min temp (night)12.6 °C 8.20–13.8

Precipitation76.6 mm/mo 64.6–101

Air humidity60.7 % 58.1–64.3

Moisture balance-32.3 mm/mo -60.7–24.3

Vapour deficit748 Pa 519–775

Wind speed3.40 m/s 1.80–4.40

Cloud cover44.0 % 39.7–54.8

CHELSA 1981–2010, ~9 km grid, at location & month of 41 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)