Stylochus ellipticus

(Girard, 1850) · species

image placeholder — illustration coming later

Animalia/Platyhelminthes/Turbellaria/Stylochidae/Stylochus

At a glance

Occurrence records125

Data sources9

Biological traits1

DNA specimens5

eDNA detections7

Sources9 archives

Databases and archives Stylochus ellipticus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility88 records↗

OBISOcean Biodiversity Information System37 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF · OBIS125 records

Environmental DNA3 datasets · 3 countries7 detections

DNA & barcodingBOLD5 specimens

Genome at a glanceGoaT2n = 20

01Narrative

Stylochus ellipticus is een platworm (Platyhelminthes). De worm is tweeslachtig. De soort leeft in het zoute water. Het geslacht Stylochus, waarin de platworm wordt geplaatst, wordt tot de familie Stylochidae gerekend. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1850 door Girard.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment1

Habitat saltwateryes

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stylochus ellipticus has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections7

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P633 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)1.1%

Haplotypes2

BIN1

Most divergent pair0.79%

Where individuals differ — all 13 variable positions, in barcode order

199Tmostly conserved

201Tmostly conserved

203Cmostly conserved

205Tmostly conserved

208Amostly conserved

209Tmostly conserved

210Amostly conserved

211Tmostly conserved

271Tmostly conserved

364Cvariable

400Cvariable

613Cvariable

616Avariable

TACATTATATTTAATATTTGGAATTTGATCGGGTCTAGTAGGAACTGCGTTTAGGTTTTTAATTCGTTCAGAGTTAGCCCAACCTGGGAC …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Stylochus ellipticus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 201×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type125 records

Wild obs. + sensor37

Museum / vouchered86

Other2

Origin

Native1

Range

Area of Occupancy AOO212 km²

Depth

0–200 m sunlit18

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 3 m · max 13.7 m · 18 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 36 without coordinates

Open the mapobservation + sensor37

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 20>10 km 35

55 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence86

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	54
Washington, US	23
Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institutelocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Cambridge, US	1
Texas Cooperative Wildlife Collectionlocation not on record	1

6 institutions · 81 of 86 vouchered records shown · 3 without an institution code

09Environmental DNA7 detections

Where the DNA of Stylochus ellipticus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys3

Countries3

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 12.5–20.2

Seasonal swing summer↔winter16.9 °C

Max temp (day)16.9 °C 15.4–22.4

Min temp (night)11.8 °C 10.1–18.1

Precipitation90.3 mm/mo 70.0–92.5

Air humidity62.9 % 61.1–64.2

Moisture balance22.1 mm/mo

Vapour deficit597 Pa 517–938

Wind speed4.90 m/s

Cloud cover48.0 % 40.4–49.1

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)