Stylidium debile

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Stylidiaceae/Stylidium

At a glance

Occurrence records293

Data sources4

Biological traits28

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Stylidium debile's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility293 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources28 traits

Occurrence & distributionGBIF293 records

DNA & barcodingNCBIsequences

01Narrative

Stylidium debile, commonly known as the frail triggerplant, is a carnivorous, dicotyledonous plant that belongs to the genus Stylidium (family Stylidiaceae). S. debile is endemic to coastal areas in Queensland and New South Wales, Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology10

Fruit length7 mm

Leaf length17.5 mm

Leaf length max30 mm

Leaf length min5 mm

Leaf width6 mm

Leaf width max8 mm

Leaf width min4 mm

Seed length0.47 mm

Seed mass0.013 mg

Seed width0.29 mm

Life cycle & reproduction6

Dehiscencedehiscent

Flowering timeyyyyynnnyyyy

Life spanperennial

Reproductive maturity2 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapeobovate spathulate

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stylidium debile has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

rbcLMZ239203.1 ↗150 105 bp

ACGT

CCCTTTTTAGTTCAGTTCAAATTAGTTCAAAAACTTGTATACACTCATCCTAATACTAGGGTTTTATCCATTTGTAGATGGAGCTTCAAT …

Stylidium debile chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

08Occurrence & distribution

Record type293 records

Wild obs. + sensor127

Museum / vouchered145

Cultivated / captive2

Other19

Origin

Native36

Range

Area of Occupancy AOO904 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 86≤1 km 18≤10 km 4>10 km 10

118 georeferenced · 9 without coordinates

Open the mapobservation + sensor127

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤100 m 24≤1 km 6≤10 km 66>10 km 33

129 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence145

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	66
Mount Annan, AU	35
Museo Entomologico de Leonlocation not on record	25
Canberra, AU	5
Armidale, AU	4
Adelaide, AU	3
John T. Waterhouse Herbariumlocation not on record	2
Davis, US	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Kew, GB	1
Palmerston, AU	1
Smithfield, AU	1

12 institutions · 145 of 145 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)