Stuckenia pectinata
(L.) Börner · speciesAt a glance
Occurrence records120 710
Data sources14
Biological traits137
DNA specimens66
eDNA detections46
Sources14 archives
Databases and archives Stuckenia pectinata's data was compiled from.
WikipediaWikimedia Foundation7 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility106 438 records↗
OBISOcean Biodiversity Information System14 272 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI46 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics66 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources137 traits
Occurrence & distributionGBIF · OBIS120 710 records
Environmental DNA4 datasets · 13 countries46 detections
DNA & barcodingBOLD · NCBI66 specimens
Genome at a glanceCCDB · GoaT · NCBI880 Mbp
01Narrative
Stuckenia pectinata (syn. Potamogeton pectinatus), commonly called sago pondweed or fennel pondweed, and sometimes called ribbon weed, is a cosmopolitan water plant species that grows in fresh and brackish water on all continents except Antarctica.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesTRYAusTraitsLEDAGIFTWCVPUSDA
Size & morphology21
Fruit length4.5 mm
Fruit width2.5 mm
Leaf length150 mm
Leaf length max15 mm
Leaf length min3 mm
Leaf mass0.591 mg
Leaf size32 mm²
⚠ sources differ — TRY: 32 mm² · AusTraits: 1 898 mm² · LEDA: 19.62 mm² · GIFT: 19.62 mm²
Leaf width1.12 mm
⚠ sources differ — AusTraits: 1.12 mm · GIFT: 8 mm
Leaf width max17 mm
Plant height1 m
⚠ sources differ — GIFT: 1 m · AusTraits: 2 m · TRY: 2.62 m
Plant height generative1.65 m
Plant height max4 m
Plant height min0.1 m
Seed length4 mm
⚠ sources differ — TRY: 4 mm · AusTraits: 3.5 mm
Seed mass5.17 mg
⚠ sources differ — TRY: 5.17 mg · AusTraits: 4.51 mg · LEDA: 5.27 mg · GIFT: 4.55 mg
Seed mass max6.28 mg
Seed mass min5.27 mg
Seed volume9.3 mm³
Seed volume max9.3 mm³
Seed volume min9.3 mm³
Seed width2.25 mm
Life cycle & reproduction37
Bloom periodMid Spring
Coppice potentialNo
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typewater
⚠ sources differ — AusTraits: hydrochory · LEDA: endozoochor · GIFT: hydrochorous
Flower colourgreen
Flower conspicuousNo
Flowering endSep
Flowering startJun
Flowering timeyyyyynnnyyyy
Fruit seed period beginSpring
Fruit seed period endFall
Growth rate USDASlow
Life formrhizomatous hydrogeophyte
Life spanperennial
Lifespan categoryModerate
Pollination modeabiotic
Pollination syndromewind
⚠ sources differ — AusTraits: wind · GIFT: insect
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Raunkiær life formcryptophyte
Reproduction asexualabsent
Resprout abilityNo
Resprouting capacityresprouts
Seed number140
Seed spread rateRapid
Seedling vigorMedium
Self fertilizationabsent
Sex typehermaphrodite+monoecious
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment33
Active growth periodSummer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticaquatic
BloatNone
Climatetemperate
Climberself-supporting
Elevation max4 600 m
Elevation mean0 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureFine
Fruit colourblue
Fruit fleshinessdry
Fruit typenut
⚠ sources differ — AusTraits: nutlet · GIFT: drupe
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: hydrophyte
Growth form USDASingle Crown
Habitat GIFTlakes, rivers, swamps
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesssimple
Leaf retentionNo
Leaf shapelinear
Low growing grassNo
Mycorrhiza type0.120812396
Root depth min0 in
Shape and orientationDecumbent
Small grainNo
Woodinessnon-woody
Physiology & chemistry25
Anaerobic toleranceHigh
Caco3 toleranceHigh
Cold stratification requiredNo
Drought toleranceNone
Fertility requirementMedium
Fire resistantNo
Frost free days min125 days
Leaf C:N ratio12.01 g/g
Leaf c438 mg/g
Leaf dry-matter content (LDMC)161 mg/g
⚠ sources differ — TRY: 161 mg/g · LEDA: 198 mg/g
Leaf n36.5 mg/g
Leaf p5.61 mg/g
Moisture useHigh
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min12 in
Salinity toleranceMedium
Seed longevity index0
Shade toleranceHigh
Soil pH max8.5 pH
Soil pH min6 pH
Specific leaf area (SLA)66.41 mm²/mg
⚠ sources differ — TRY: 66.41 mm²/mg · LEDA: 43.9 mm²/mg · GIFT: 43.9 mm²/mg
Temperature min-38 °F
Uses & economy12
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable humanNo
Post productNo
Pulpwood productNo
ToxicityNone
Veneer productNo
Other traits7
Diaspore typegenerative dispersule
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max4 800 per acre
Planting density min3 450 per acre
05DNA & barcoding66 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stuckenia pectinata has left across the world's sequence archives.
At a glance
DNA specimens66
Marker genes6
GenBank sequences9
eDNA detections46
Countries14
The DNA barcodea real sequence read deposited for this species
GTGAACCTGCGGAAGGATCATTGACAACGTCCCTTATTCTAGACCAAGAACACGTGACCTATCGAGTACATGCGTAGTGTGATCTTCGAT …
Stuckenia pectinata isolate 3210 clone 9 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL1★rbcLa★ITS8★ITS2atpB-rbcL
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Stuckenia pectinata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size880 200 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Stuckenia pectinata0.88 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 78 n = 39
Ploidypolyploid inferred
Chromosome records26–862n range78median78mode28records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 7821×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · croinout +9
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Uhríková A. & Feráková V., 1978: [Report], pp. 379. - In: Löve Á. (ed.), IOPB Chromosome Number Reports LXI, Taxon 27 /4.
CCDB · croinout — Takusagawa, H. 1961
CCDB · croinout — Scheerer, H. 1939
CCDB · croinout — Lve, A. & Lve, D. 1942
CCDB · croinout — Love, A. & Love, D. 1981
CCDB · croinout — Arohonka, T. 1982
CCDB · croinout — Kalkman, L. & Van Wijk, R. J. 1984
CCDB · croinout — Probatova, N. S. & Sokolovskaya, A. P. 1986
CCDB · croinout — Uhrikova, A. & Majovsky, J. 1978
CCDB · fl-europaea — Palmgren, 1942
CCDB · poland — ?ukowski and Anders (unpubl.)
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · book-ipcn66 — Love & Ritchie 1966
CCDB · book-ipcn67-71 — Q31 TAKUSAGAWA, H. 1961. Cytological studies in the genus Potamogeton of Japan. Bull. Shimane Agr. Col. 9: 1-3Q.
CCDB · book-ipcn75-78 — Uhrikova & Majovsky 1978
CCDB · book-indian_vol2 — Scheerer, H. 1939 ; Palmaren. 0. (L~ve, A. & Uve, D. 1942b); Takusagawa, H. 1961 ; Bhat, B.K. et al. 1975
CCDB · book-indian_vol2 — Uhrikova, A. & Fenikova, V. 1978
CCDB · eflora
CCDB · book-atlas-flowering-plants — Harada 1942
2n 423×CCDB · croinout · CCDB · book-ipcn66 · CCDB · book-ipcn73-74
CCDB · croinout — Misra, M. P. 1972
CCDB · book-ipcn66 — Misra 1966
CCDB · book-ipcn73-74 — MISRA, M.P. 1972. Cytological studies in some Indian Potarnogeton and Aponogeton species. Bull. Bot. Soc. Bengal 26(1): 47-51.
2n 842×CCDB · croinout · CCDB · ipcn-api-dl
CCDB · croinout — Uchiyama, H. 1989
CCDB · ipcn-api-dl — Uchiyama, H. 1989. Karyomorphological studies on some taxa of the Helobiae. J. Sci. Hiroshima Univ., Ser. B, Div. 2, Bot. 22: 271–352.
2n 261×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 13
2n 861×CCDB · croinout
CCDB · croinout — Yurtsev, B. A., Zhukova, P. G., Plieva, T. V., Raszhivin, V. Yu. & Sekretareva. 1975
n 392×CCDB · croinout · CCDB · book-ipcn75-78
CCDB · croinout — Bhat, B. K., Bakshi, S. K. & Kaul, M. K. 1975
CCDB · book-ipcn75-78 — Bhat et al. 1975
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=1.000 ↗
polyploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness94.4% BUSCO
07Deep time~16.7 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin16.7 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type120 710 records
Wild obs. + sensor83 491
Museum / vouchered22 812
Cultivated / captive4
Other14 403
Origin
Native6 579
Range
Area of Occupancy AOO108 424 km²
Depth
0–200 m sunlit12 306
200–1000 m twilight0
1–4 km midnight0
>4 km abyssal0
median 2 m · max 21.5 m · 12 306 records with depth
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy70% within 1 km
≤100 m 40 696≤1 km 13 147≤10 km 22 738>10 km 316
76 897 georeferenced · 6 594 without coordinates
Open the mapobservation + sensor83 491
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy54% within 1 km
≤100 m 1 910≤1 km 1 841≤10 km 1 914>10 km 1 240
6 905 georeferenced · 15 907 without coordinates
Open the institutions mapphysical evidence22 812
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 4 records without
Open the mapnot free-living4
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions132 of 237 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| 730location not on record | 2 743 |
| Helsinki, FI | 1 020 |
| Uniwersytet Wrocławskilocation not on record | 803 |
| Metsähallituslocation not on record | 780 |
| LDlocation not on record | 635 |
| TÜ_EMIlocation not on record | 613 |
| Moscow State Universitylocation not on record | 549 |
| DBF-NHMDlocation not on record | 377 |
| St. Paul, US | 277 |
| Brussel, BE | 276 |
| Madison, US | 275 |
| SLU Artdatabankenlocation not on record | 226 |
| Irkutsk State Universitylocation not on record | 197 |
| Oulu, FI | 169 |
| Ann Arbor, US | 159 |
| Olocation not on record | 154 |
| MeiseBGlocation not on record | 137 |
| BIO-UNIPIlocation not on record | 136 |
| Wuzhou, CN | 134 |
| Oskarshamn, SE | 132 |
| Turku, FI | 116 |
| Adelaide, AU | 111 |
| Museo Entomologico de Leonlocation not on record | 107 |
| Pullman, US | 105 |
| BRNUlocation not on record | 98 |
| Chongqing Museumlocation not on record | 90 |
| Tsukuba, JP | 87 |
| Saint John, CA | 82 |
| Green Bay, US | 81 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 74 |
| San Diego, US | 67 |
| Claremont, US | 65 |
| Université Lavallocation not on record | 64 |
| Bloomington, US | 62 |
| Acadia Universitylocation not on record | 61 |
| Mexico City, MX | 57 |
| Flagstaff, US | 57 |
| ASUlocation not on record | 56 |
| Auckland, NZ | 52 |
| Santa Barbara, US | 51 |
| Kuopio, FI | 51 |
| DULlocation not on record | 51 |
| WTUlocation not on record | 50 |
| Mount Annan, AU | 47 |
| Christchurch, NZ | 47 |
| PRClocation not on record | 44 |
| International Salmonella Centre (W.H.O.)location not on record | 44 |
| Kensington, AU | 41 |
| Trondheim, NO | 41 |
| TUR-Alocation not on record | 34 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 34 |
| Bergen, NO | 34 |
| University of Stellenboschlocation not on record | 32 |
| Brisbane, AU | 32 |
| TROMlocation not on record | 31 |
| University of New Hampshirelocation not on record | 31 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 31 |
| Canberra, AU | 30 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 29 |
| BSBIlocation not on record | 28 |
| Burlington, US | 28 |
| University of Alberta Museumslocation not on record | 27 |
| Spearfish, US | 26 |
| Logan, US | 26 |
| Tampa, US | 26 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 26 |
| Chadron, US | 25 |
| Montréal, CA | 24 |
| Fort Worth, US | 22 |
| Austin, US | 22 |
| Whitewater, US | 22 |
| Hobart, AU | 21 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 21 |
| QVMAGlocation not on record | 19 |
| US | 18 |
| Victoria, CA | 18 |
| Dekalb, US | 17 |
| Institute of the biological problems of the North FEB RASlocation not on record | 17 |
| San Luis Obispo, US | 17 |
| Lubbock, US | 15 |
| KMNlocation not on record | 15 |
| Millersville, US | 14 |
| Denver, US | 14 |
| Palmerston, AU | 13 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 13 |
| Porvoo, FI | 13 |
| Córdoba, AR | 13 |
| Davis, US | 12 |
| Durham, US | 12 |
| Provincia di Livornolocation not on record | 12 |
| Bangkok, TH | 12 |
| Caldwell, US | 12 |
| Anchorage, US | 11 |
| College Park, US | 10 |
| Yukon Universitylocation not on record | 10 |
| GB | 10 |
| Arcata, US | 10 |
| Los Angeles, US | 9 |
| John T. Waterhouse Herbariumlocation not on record | 9 |
| Vancouver, CA | 9 |
| Saint Louis, US | 9 |
| Whitehorse, CA | 8 |
| Albuquerque, US | 8 |
| Moscow, US | 7 |
| Phoenix, US | 7 |
| CASlocation not on record | 6 |
| Corvallis, US | 6 |
| Canadian Department of Agriculturelocation not on record | 6 |
| Portland, US | 6 |
| Berlin, DE | 6 |
| South Kensington, GB | 6 |
| Stockholm, SE | 6 |
| Lord Fairfax Community Collegelocation not on record | 6 |
| Riverside, US | 5 |
| Toronto, CA | 5 |
| DOI/NPS, Greenbelt Parklocation not on record | 5 |
| Chicago, US | 5 |
| IDElocation not on record | 5 |
| Tuscaloosa, US | 5 |
| University of Winnipeglocation not on record | 5 |
| Fargo, US | 5 |
| Irvine, US | 5 |
| Columbia, US | 4 |
| Québec, CA | 4 |
| Rotorua, NZ | 4 |
| Bern, CH | 4 |
| Missoula, US | 4 |
| University of Birminghamlocation not on record | 4 |
| Royal Botanic Garden Edinburghlocation not on record | 4 |
| B.A. Bennett Herbariumlocation not on record | 4 |
| McWane Science Centerlocation not on record | 4 |
| Durango, US | 4 |
| Tula State Universitylocation not on record | 4 |
| Oswego, US | 4 |
| Sion, CH | 4 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Mount Pleasant, US | 3 |
| Wellington, NZ | 3 |
| Kew, GB | 3 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 3 |
| US | 3 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 3 |
| Severin-McDaniel Insect Collectionlocation not on record | 3 |
| BClocation not on record | 3 |
| Pittsburg, US | 3 |
| San Angelo, US | 3 |
| La Paz, MX | 3 |
| Porrentruy, CH | 3 |
| nbflocation not on record | 3 |
| Catalina Island Conservancylocation not on record | 3 |
| Northridge, US | 3 |
| Tacoma, US | 3 |
| Boise, US | 3 |
| Plocation not on record | 2 |
| Boumlocation not on record | 2 |
| Parkville, AU | 2 |
| University of Technologylocation not on record | 2 |
| Pocatello, US | 2 |
| Hokkaido University Museumlocation not on record | 2 |
| Bronx, US | 2 |
| The University of Arizonalocation not on record | 2 |
| Cambridge, US | 2 |
| Universidade Federale do Rio Grande do Sullocation not on record | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Orem, US | 2 |
| University of Leicesterlocation not on record | 2 |
| Juriquilla, MX | 2 |
| Tampere, FI | 2 |
| Brookings, US | 2 |
| WINlocation not on record | 2 |
| Samara National Research Universitylocation not on record | 2 |
| Edinburgh, GB | 2 |
| BMlocation not on record | 2 |
| Siberian Federal Universitylocation not on record | 2 |
| Mexico City, MX | 2 |
| La Trobe Universitylocation not on record | 2 |
| Norfolk, US | 2 |
| Chicago, US | 2 |
| Cambridge University Herbariumlocation not on record | 2 |
| Maryland Department of Natural Resourceslocation not on record | 2 |
| Manchester Museum, University of Manchesterlocation not on record | 2 |
| Tromso University Museumlocation not on record | 2 |
| CICYTEXlocation not on record | 2 |
| Ypsilanti, US | 2 |
| Wlocation not on record | 2 |
| Kyoto Universitylocation not on record | 2 |
| Royal Alberta Museumlocation not on record | 1 |
| VALElocation not on record | 1 |
| Canadian Museum of Naturelocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| San Luis Potosí, MX | 1 |
| Weber State Universitylocation not on record | 1 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 1 |
| CJBGlocation not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Santiago, CL | 1 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 1 |
| PRlocation not on record | 1 |
| Bourges, FR | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| AUAlocation not on record | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| BISHlocation not on record | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Santa Cruz, US | 1 |
| Göteborg, SE | 1 |
| Armidale, AU | 1 |
| Elocation not on record | 1 |
| US | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Tallinn, EE | 1 |
| Cochabamba, BO | 1 |
| Hermosillo, MX | 1 |
| Rocky Mountain Biological Laboratorylocation not on record | 1 |
| CGE|NMWlocation not on record | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Durango, MX | 1 |
| Denton, US | 1 |
| Nishihara, JP | 1 |
| National Museum Waleslocation not on record | 1 |
| Xiamen, CN | 1 |
| UIBlocation not on record | 1 |
| USFSlocation not on record | 1 |
| Jackson, US | 1 |
| Provo, US | 1 |
| Knoxville, US | 1 |
| Henderson, US | 1 |
| Palmerston North, NZ | 1 |
| BG-NMNHSlocation not on record | 1 |
| Fairfax, US | 1 |
| Ashland, US | 1 |
| GAlocation not on record | 1 |
| Mississippi State, US | 1 |
| Bend, US | 1 |
| Montréal, CA | 1 |
| Tempe, US | 1 |
| SYKE- Okko Outinenlocation not on record | 1 |
237 institutions · 13 122 of 22 812 vouchered records shown · 9 644 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA46 detections
Where the DNA of Stuckenia pectinata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found46
Studies independent surveys4
Countries13
Verifiable raw sequence linked3
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 46 detections have coordinates
Open the map13 countries0
Submerged in shallow saline pond ~1' deep, n…in 6 inches water of small pondAquatic, "Lands end", extreme low of delta.in pondRapidly flowing water 50cm deep over stones …
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Measured at samplingin-field
Temperature9.12 °C
pH7.99
Conductivity28,000 µS/cm
Salinity16.9 PSU
Dissolved oxygen10.1 mg/L
Turbidity3.25 NTU
Depth0.5 m
Coastal water
1 sample with on-site data · median with range · describes the sample, not the organism
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.5 °C 7.40–16.7
Seasonal swing summer↔winter20.8 °C
Max temp (day)15.8 °C 9.70–21.0
Min temp (night)8.70 °C 3.10–14.4
Precipitation68.7 mm/mo 15.1–110
Air humidity62.3 % 48.8–67.1
Moisture balance-19.3 mm/mo -94.0–38.2
Vapour deficit632 Pa 375–827
Wind speed4.00 m/s 2.30–6.40
Cloud cover44.6 % 25.0–62.2
CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.