Strychnos usambarensis

Gilg ex Engl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Loganiaceae/Strychnos

At a glance

Occurrence records160

Data sources12

Biological traits19

DNA specimens11

eDNA detections7

Sources12 archives

Databases and archives Strychnos usambarensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility160 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Chemical compositionLOTUS · NPASS52 compounds

Occurrence & distributionGBIF160 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD · NCBI11 specimens

Genome at a glanceCCDB2n = 44

01Narrative

Strychnos usambarensis est une espèce de plantes dicotylédones de la famille des Loganiaceae, originaire de l'Afrique tropicale. Ce sont des arbustes pouvant atteindre 5 mètres de haut ou de petits arbres très ramifiés de 10 à 15 mètres de haut, ou de grandes lianes, pouvant grimper dans les arbres jusqu'à 70 m de long. Ces plantes contiennent de nombreux alcaloïdes, dont certains ont un effet paralysant des muscles, analogue à celui du curare. Les tribus bantoues du Rwanda et de Tanzanie produisent un poison de flèche à partir de l'écorce des racines et des feuilles de cette espèce, en les combinant parfois avec des extraits d'autres plantes. L'épithète spécifique, usambarensis, est une référence aux monts Usambara de Tanzanie.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height17 m

⚠ sources differ — GIFT: 17 m · TRY: 5 m

Plant height max24.38 m

Plant height min1 m

Seed mass490 mg

Life cycle & reproduction3

Life formscrambling shrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberobligatory

Elevation max1 370 m

Elevation min30 m

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · TRY: climber

Habitat GIFTdry forest, evergreen thicket, riverine forest, also moist forest

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Wood density715 mg/cm³

03Chemical composition52 compounds

Compounds documented for Strychnos usambarensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Corynanthe type35

Carboline alkaloids $ Corynanthe type10

Naphthoquinones4

Carboline alkaloids3

Strychnos type1

Documented compounds52 total

Tissue Source Quantified only

Compound	Amount	Source
(19E)-4-methylsarpagan-4-ium-17-ol	present	LOTUS
(1R,11S,12R,13R,14E,19S,21S)-14-ethylidene-10-[(2S,3E)-3-ethylidene-2,4-dihydro-1H-indolo[2,3-a]quinolizin-2-yl]-8,16-diazahexacyclo[11.5.2.11,8.02,7.016,19.012,21]henicosa-2,4,6,9-tetraen-11-ol	present	LOTUS
(1S,11R,12S,13R,14Z,19S,21S)-10-(3-ethyl-7,12-dihydro-6H-indolo[2,3-a]quinolizin-5-ium-2-yl)-14-ethylidene-16-methyl-8-aza-16-azoniahexacyclo[11.5.2.11,8.02,7.016,19.012,21]henicosa-2,4,6,9-tetraen-11-ol	present	LOTUS
(2R,3E,12bS)-2-(4,9-dihydro-3H-pyrido[3,4-b]indol-1-ylmethyl)-3-ethylidene-2,4,6,7,12,12b-hexahydro-1H-indolo[2,3-a]quinolizine	present	LOTUS
(2R,3R,12bS)-3-ethyl-11-[(2S)-1-methylpyrrolidin-2-yl]-2-[[(1S)-2-methyl-1,3,4,9-tetrahydropyrido[3,4-b]indol-1-yl]methyl]-1,2,3,4,6,7,7a,12,12a,12b-decahydroindolo[2,3-a]quinolizin-10-ol	present	LOTUS
(2R,3Z,12bR)-3-ethylidene-2-(9H-pyrido[3,4-b]indol-1-ylmethyl)-2,4,6,7,12,12b-hexahydro-1H-indolo[2,3-a]quinolizine	present	LOTUS
(2S,3R,12bS)-3-ethenyl-11-[(2R)-1-methylpyrrolidin-2-yl]-2-[[(1S)-2-methyl-1,3,4,9-tetrahydropyrido[3,4-b]indol-1-yl]methyl]-1,2,3,4,6,7,12,12b-octahydroindolo[2,3-a]quinolizin-10-ol	present	LOTUS
(2S,3R,12bS)-3-ethenyl-2-[[(1R)-2-methyl-1,3,4,9-tetrahydropyrido[3,4-b]indol-1-yl]methyl]-1,2,3,4,6,7,12,12b-octahydroindolo[2,3-a]quinolizin-9-ol	present	LOTUS
(2S,3R,12bS)-3-ethenyl-2-[[(1S)-2-methyl-1,3,4,9-tetrahydropyrido[3,4-b]indol-1-yl]methyl]-1,2,3,4,6,7,12,12b-octahydroindolo[2,3-a]quinolizin-10-ol	present	LOTUS
(2S,3R,12bS)-3-ethyl-2-[[(1S)-2-methyl-1,3,4,9-tetrahydropyrido[3,4-b]indol-1-yl]methyl]-1,2,3,4,6,7,12,12b-octahydroindolo[2,3-a]quinolizin-10-ol	present	LOTUS

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Strychnos usambarensis has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes5

GenBank sequences7

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKC609319.1 ↗402 bpSouth Africa · 2008

ACGT

TCGATGAAGAACGCAGCAAACTGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAG …

Strychnos usambarensis voucher UDW:A Adebowale 54 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★rbcLa★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Strychnos usambarensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 441×CCDB · book-fedorov

CCDB · book-fedorov — Mangenot S., Mangenot G. 1962

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type160 records

Wild obs. + sensor90

Museum / vouchered70

Range

Area of Occupancy AOO452 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 39≤1 km 15≤10 km 5

59 georeferenced · 31 without coordinates

Open the mapobservation + sensor90

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 68 without coordinates

Open the institutions mapphysical evidence70

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	30
TAFORI-LSRClocation not on record	8
Paris, FR	4
University of Johannesburglocation not on record	3
Leiden University Medical Centerlocation not on record	2
University of Stellenboschlocation not on record	2
MAlocation not on record	1
CNF-UFHBlocation not on record	1
Beijing, CN	1
UJlocation not on record	1
Uppsala, SE	1
University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record	1

12 institutions · 55 of 70 vouchered records shown · 12 without an institution code

09Environmental DNA7 detections

Where the DNA of Strychnos usambarensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.2 °C 17.7–23.9

Seasonal swing summer↔winter8.00 °C

Max temp (day)26.6 °C 24.6–28.5

Min temp (night)14.2 °C 11.2–19.6

Precipitation25.8 mm/mo 15.2–111

Air humidity56.3 % 48.3–61.4

Moisture balance-64.8 mm/mo -98.6–-10.4

Vapour deficit1,134 Pa 970–1,188

Wind speed2.10 m/s 1.90–2.90

Cloud cover16.6 % 14.4–40.3

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)