Strychnos toxifera

M.R.Schomb. ex Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Loganiaceae/Strychnos

At a glance

Occurrence records72

Data sources9

Biological traits20

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Strychnos toxifera's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility72 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Chemical compositionLOTUS11 compounds

Occurrence & distributionGBIF72 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Strychnos toxifera, called bush rope and devil doer, is a species of flowering plant in the genus Strychnos, native to Costa Rica, Panama, Colombia, Ecuador, Venezuela, the Guianas, Brazil, Peru and Bolivia. It is the principal source of calabash or gourd curare. Macusine B is an alkaloid inhibitor of adrenergic alpha-receptors and tryptamine receptors that can be isolated from Strychnos toxifera.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Deciduousnessevergreen

Life formliana

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberobligatory

Elevation max1 000 m

Elevation mean250 m

Elevation min0 m

Epiphyteterrestrial

Growth formclimber

Habitat GIFTFloresta de Igapó, Floresta de Terra Firme

Woodinesswoody

Physiology & chemistry6

Leaf dry-matter content (LDMC)382 mg/g

Leaf n19.6 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)17.26 mm²/mg

Wood density695 mg/cm³

03Chemical composition11 compounds

Compounds documented for Strychnos toxifera across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Corynanthe type8

Corynanthe type $ Strychnos type3

Documented compounds11 total

Tissue Source Quantified only

Compound	Amount	Source
(13-Ethylidene-11-methyl-1-aza-11-azoniapentacyclo[12.3.1.02,7.08,17.011,16]octadeca-2,4,6,8(17)-tetraen-18-yl)methanol	present	LOTUS
(19E)-4-methylsarpagan-4-ium-17-ol	present	LOTUS
(1S,3aR,9R,9aR,10R,11aS,12S,14aR,19aR,20R,20aS,20bS,21R,22aS)-2,3,9a,11,11a,13,14,19a,20a,20b,22,22a-Dodecahydro-10H,21H-1,23:12,27-dimethano-9,10:20,21-bis(epoxy(2)propeno)-9H,20H-dipyrrolo(2,3-d:2',3'-d')(1,5)diazocino(1,2,3-lm:5,6,7-l'm')dicarbazole	present	LOTUS
10-Methoxynormacusine B; 10-O-Methylsarpagine	present	LOTUS
[(13E,14S,16S,18R)-13-ethylidene-11-methyl-1-aza-11-azoniapentacyclo[12.3.1.02,7.08,17.011,16]octadeca-2,4,6,8(17)-tetraen-18-yl]methanol	present	LOTUS
[(1S,12S,13R,14R,15E,17R)-15-ethylidene-17-methyl-3-aza-17-azoniapentacyclo[12.3.1.0^{2,10.0^{4,9.0^{12,17]octadeca-2(10),4,6,8-tetraen-13-yl]methanol	present	LOTUS
[(1S,13S,14S,15E,17R)-15-Ethylidene-17-methyl-3-aza-17-azoniapentacyclo[12.3.1.02,10.04,9.012,17]octadeca-2(10),4,6,8-tetraen-13-yl]methanol	present	LOTUS
Calebassine	present	LOTUS
Panarine	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Strychnos toxifera has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences8

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJF938056.1 ↗614 bp

ACGT

ACGAATCCTGCAGACGACCCGCGAACACGTTTCTCCCCACGGGCGTCGGGAGGGGGCGACCCCATCTCGGCCTCGTCCTGCGAGCGGCCC …

Strychnos toxifera voucher J. S. Bissett 275 (CHRB) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type72 records

Wild obs. + sensor7

Museum / vouchered65

Range

Area of Occupancy AOO188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤1 km 2>10 km 2

4 georeferenced · 3 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤1 km 8≤10 km 12>10 km 3

23 georeferenced · 42 without coordinates

Open the institutions mapphysical evidence65

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	19
Universidad de Antioquia (UdeA)location not on record	16
University of Stellenboschlocation not on record	6
Museo Nacional de Costa Rica (MNCR)location not on record	5
National Biodiversity Institute, Costa Ricalocation not on record	5
Universidad de Caldas (UCaldas)location not on record	4
Universidad Nacional de Colombia (UNAL)location not on record	3
MAlocation not on record	2
Universidad Católica de Oriente (UCO)location not on record	1
Kew, GB	1

10 institutions · 62 of 65 vouchered records shown · 3 without an institution code

09Environmental DNA2 detections

Where the DNA of Strychnos toxifera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)