Strychnos pungens

Soler. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Loganiaceae/Strychnos

At a glance

Occurrence records534

Data sources7

Biological traits27

DNA specimens6

eDNA detections5

Sources7 archives

Databases and archives Strychnos pungens's data was compiled from.

GBIFGlobal Biodiversity Information Facility534 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources27 traits

Chemical compositionNPASS12 compounds

Occurrence & distributionGBIF534 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI6 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology9

Plant height5 m

Plant height max8 m

Plant height min0.6 m

Seed mass3 286 mg

Seed mass max3 286 mg

Seed mass min3 286 mg

Seed volume4 000 mm³

Seed volume max4 000 mm³

Seed volume min4 000 mm³

Life cycle & reproduction3

Deciduousnessvariable

⚠ sources differ — TRY: deciduous/evergreen · GIFT: evergreen

Life formshrub or tree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 755 m

Elevation min120 m

Epiphyteterrestrial

Growth formtree

Habitat GIFTBrachystegia woodland

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry4

Leaf n12.65 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density702 mg/cm³

03Chemical composition12 compounds

Compounds documented for Strychnos pungens across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Hydrocarbons1

Documented compounds12 total

Tissue Source Quantified only

Compound	Amount	Source
AZGANZVUWUCOGH-ZABKPZAWSA-N	present	NPASS
Enterocin	present	NPASS
Ethane	present	NPASS
MFEPAAMYDYMBSN-FLXOHRQISA-N	present	NPASS
OIJZDPGKNVKVBL-UCROKIRRSA-N	present	NPASS
Pyrazofurin	present	NPASS
RXKCHPQFBWGDEU-UYRRIVOBSA-N	present	NPASS
UDJLOBNQKOOLFE-DCIGPNSNSA-N	present	NPASS
UTIFRWPUJPPZEZ-ULYYURGISA-N	present	NPASS
VMULEITVZASJMA-MAPXQVSGSA-N	present	NPASS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Strychnos pungens has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes5

GenBank sequences10

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMW381785.1 ↗299 bp

ACGT

GGAACGGATGCCTGTTTTTCACGCATCGCGTCGACCCCCCCACACGCCGACCCAGGCCGTGCGAGGGGGACGGATAATGGCCTCCCGTGC …

Strychnos pungens voucher WMSPITS2.1 internal transcribed spacer 2 and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL2★rbcLa★ITS5★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type534 records

Wild obs. + sensor341

Museum / vouchered193

Range

Area of Occupancy AOO1 248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 194≤1 km 41≤10 km 16>10 km 1

252 georeferenced · 89 without coordinates

Open the mapobservation + sensor341

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 3

4 georeferenced · 189 without coordinates

Open the institutions mapphysical evidence193

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	109
Saint Louis, US	13
MeiseBGlocation not on record	12
TAFORI-LSRClocation not on record	8
Adam Mickiewicz University in Poznańlocation not on record	6
Durban, ZA	4
Dresden, DE	4
Paris, FR	3
Kew, GB	3
Instituto de Investigação Científica Tropicallocation not on record	2
Stockholm, SE	1
MSB-3054location not on record	1
South African National Biodiversity Institutelocation not on record	1
University of Stellenboschlocation not on record	1
Frankfurt am Main	1
Chongqing Museumlocation not on record	1
University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record	1
South Kensington, GB	1

18 institutions · 172 of 193 vouchered records shown · 19 without an institution code

09Environmental DNA5 detections

Where the DNA of Strychnos pungens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.5 °C 18.8–22.7

Seasonal swing summer↔winter13.6 °C

Max temp (day)27.1 °C 26.6–28.6

Min temp (night)13.2 °C 11.7–16.3

Precipitation34.5 mm/mo 32.1–95.3

Air humidity48.3 % 47.5–54.3

Moisture balance-98.6 mm/mo -114–-63.3

Vapour deficit1,195 Pa 1,186–1,375

Wind speed2.90 m/s 2.50–3.10

Cloud cover21.5 % 16.3–39.4

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)