Strychnos psilosperma

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Loganiaceae/Strychnos

At a glance

Occurrence records741

Data sources8

Biological traits19

DNA specimens2

eDNA detections1

Sources8 archives

Databases and archives Strychnos psilosperma's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility741 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Chemical compositionLOTUS · NPASS12 compounds

Occurrence & distributionGBIF741 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Strychnos psilosperma, known as the strychnine tree or threaded boxwood, is a shrub or small tree endemic to New South Wales and Queensland in Australia. It may reach a height of 18 metres. It occurs as far south as the Clarence River, New South Wales to Cape York at the northernmost tip of Australia. The bark is grey, with glossy pointed leaves creating a thick canopy. Small white, scented flowers occur in the warmer months. Fruit are orange to red berries, ripening to black. All parts of this plant are toxic. It may be grown in full sun with good drainage. The habitat is semi-evergreen deciduous vine forest, or mixed eucalyptus forest. A common associate tree is the Hoop Pine.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology8

Fruit length9 mm

Fruit width9 mm

Leaf length52.5 mm

Leaf width37.5 mm

Petiole length0.4 cm

Plant height6 m

Seed length8 mm

Seed width8 mm

Life cycle & reproduction4

Flowering timeyyyyyynnnnnn

Life formtree

Life spanperennial

Sex typehermaphrodite

Habitat & environment7

Climatewet tropical

Fruit fleshinessfleshy

Fruit typeberry

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree

Leaf compoundnesssimple

Leaf shapewidely_ovate

Woodinesswoody

03Chemical composition12 compounds

Compounds documented for Strychnos psilosperma across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Strychnos type5

Furofuranoid lignans2

Miscellaneous polyketides2

Iridoids monoterpenoids1

Aspidosperma-Iboga hybrid type (Vinca alkaloids) $ Strychnos type1

Documented compounds12 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Kobusin	present	NPASS
(19R)-1-Acetyl-17,19-epoxy-11-methoxycuran	present	LOTUS
(2Z,6Z,10Z,14Z,18Z,22Z,26Z,30Z,34E,38E,42E)-3,7,11,15,19,23,27,31,35,39,43,47-dodecamethyloctatetraconta-2,6,10,14,18,22,26,30,34,38,42,46-dodecaen-1-ol	present	NPASS
(3E,4S,5S)-4-hydroxy-5-methyl-3-tetradecylideneoxolan-2-one	present	NPASS
(3Z,4S,5S)-4-hydroxy-5-methyl-3-tetradecylideneoxolan-2-one	present	NPASS
(4aR,5aS,8aR,15bR)-10,11-dimethoxy-4a,5,5a,7,8,13a,15,15a,15b,16-decahydro-2H-4,6-methanoindolo[3,2,1-ij]oxepino[2,3,4-de]pyrrolo[2,3-h]quinoline-14-one	present	LOTUS
1-(19-Methyl-16,17-dihydro-2,16-cycloformosanan-1-yl)ethan-1-one	present	LOTUS
1-[(4R,12S,13R,16R,17S,18R,20S)-16-methyl-15-oxa-1,11-diazahexacyclo[15.3.1.04,12.04,20.05,10.013,18]henicosa-5,7,9-trien-11-yl]ethanone	present	LOTUS
loganin	present	LOTUS
Sesamin	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Strychnos psilosperma has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM895936.1 ↗458 bpAustralia

ACGT

GAGTAACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGA …

Strychnos psilosperma voucher 1076418821 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa

plant barcode

08Occurrence & distribution

Record type741 records

Wild obs. + sensor95

Museum / vouchered339

Cultivated / captive2

Other305

Origin

Native33

Range

Area of Occupancy AOO1 908 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 40≤1 km 5≤10 km 2>10 km 4

51 georeferenced · 44 without coordinates

Open the mapobservation + sensor95

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 94≤1 km 47≤10 km 113>10 km 53

307 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence339

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	179
Smithfield, AU	67
Museo Entomologico de Leonlocation not on record	33
Mount Annan, AU	33
Canberra, AU	8
James Cook Townsvillelocation not on record	6
Armidale, AU	3
Palmerston, AU	3
Adelaide, AU	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1

10 institutions · 334 of 339 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Strychnos psilosperma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.8 °C 19.8–19.8

Seasonal swing summer↔winter11.7 °C

Max temp (day)25.5 °C

Min temp (night)14.8 °C

Precipitation59.1 mm/mo

Air humidity56.3 %

Moisture balance-64.1 mm/mo

Vapour deficit1,031 Pa

Wind speed2.90 m/s

Cloud cover25.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)