Strychnos minor

Dennst. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Loganiaceae/Strychnos

At a glance

Occurrence records501

Data sources8

Biological traits32

DNA specimens11

eDNA detections11

Sources8 archives

Databases and archives Strychnos minor's data was compiled from.

GBIFGlobal Biodiversity Information Facility501 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources32 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF501 records

Environmental DNA1 datasets · 3 countries11 detections

DNA & barcodingBOLD · NCBI11 specimens

Genome at a glanceCCDB2n = 42

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology10

Fruit length30 mm

Fruit width30 mm

Leaf length115 mm

Leaf size2 251 mm²

⚠ sources differ — TRY: 2 251 mm² · AusTraits: 10 560 mm²

Leaf width47.5 mm

Petiole length0.55 cm

Plant height10 m

Seed length14 mm

Seed mass27 mg

Seed width12.5 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeanimal

Flowering timeynnnyyyyyyyy

Life formliana or tree

Life spanperennial

Pollination syndromemoth

Resprouting capacityresprouts

Sex typehermaphrodite

Habitat & environment8

Climatewet tropical

Climberobligatory

Fruit fleshinessfleshy

Fruit typeberry

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: climber_woody · TRY: Climber

Leaf compoundnesssimple

Leaf shapelanceolate narrowly_ovate

Woodinesswoody

Physiology & chemistry6

Leaf C:N ratio20.55 g/g

Leaf n21.1 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)9.2 mm²/mg

Wood density498 mg/cm³

03Chemical composition3 compounds

Compounds documented for Strychnos minor across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Cholestane steroids $ Stigmastane steroids1

Oleanane triterpenoids1

Stigmastane steroids1

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
17-(5-ethyl-6-methylhept-3-en-2-yl)-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	LOTUS
3-Hydroxyolean-12-en-28-oic acid	present	LOTUS
gamma-Sitosterol	present	LOTUS

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Strychnos minor has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes4

GenBank sequences10

eDNA detections11

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMZ504728.1 ↗526 bpIndia

ACGT

TTGTCGAATCCTGCAGACGACCCGCGAACTCGTTTCTCTCCACGGGCGTCGGGAGGGGGCAACCCCGTCTCGGCCCCGTTTCGCGAGCGG …

Strychnos minor isolate H09.ab1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS6★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Strychnos minor carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 421×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — HAIR, J. B. 1967. Contributions to a chromosome atlas of the New Zealand flora - 10. Hebe (Scrophulariaceael. N. z. Jour. Bot. 5: 322-3 52.

08Occurrence & distribution

Record type501 records

Wild obs. + sensor91

Museum / vouchered346

Cultivated / captive1

Other63

Origin

Native22

Range

Area of Occupancy AOO1 208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 37≤1 km 2≤10 km 2

41 georeferenced · 50 without coordinates

Open the mapobservation + sensor91

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 30≤1 km 9≤10 km 67>10 km 28

134 georeferenced · 212 without coordinates

Open the institutions mapphysical evidence346

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	66
Smithfield, AU	65
Palmerston, AU	18
Canberra, AU	10
Museo Entomologico de Leonlocation not on record	8
Kew, GB	7
St. Paul, US	6
Mount Annan, AU	5
University of Stellenboschlocation not on record	4
Pondicherry, IN	4
Fort Worth, US	4
Paris, FR	3
Honolulu, US	3
James Cook Townsvillelocation not on record	2
Cambridge University Herbariumlocation not on record	2
Stockholm, SE	1
Monastir, TN	1
BISHlocation not on record	1
South Kensington, GB	1

19 institutions · 211 of 346 vouchered records shown · 128 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA11 detections

Where the DNA of Strychnos minor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.8 °C 21.9–24.9

Seasonal swing summer↔winter4.40 °C

Max temp (day)28.5 °C 25.4–29.9

Min temp (night)20.7 °C 15.0–21.8

Precipitation137 mm/mo 15.6–341

Air humidity59.8 % 43.4–74.2

Moisture balance-8.90 mm/mo -143–252

Vapour deficit1,523 Pa 715–1,624

Wind speed2.20 m/s 2.10–4.00

Cloud cover38.6 % 18.1–49.9

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)