Strychnos madagascariensis

Poir. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Loganiaceae/Strychnos

At a glance

Occurrence records1 588

Data sources10

Biological traits32

DNA specimens21

eDNA detections14

Sources10 archives

Databases and archives Strychnos madagascariensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 588 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources32 traits

Chemical compositionLOTUS · NPASS9 compounds

Occurrence & distributionGBIF1 588 records

Environmental DNA1 datasets · 2 countries14 detections

DNA & barcodingBOLD · NCBI21 specimens

01Narrative

Mã tiền Madagascar là một loài thực vật có hoa trong họ Mã tiền. Loài này được Poir. miêu tả khoa học đầu tiên năm 1808.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology10

Plant height6 m

⚠ sources differ — GIFT: 6 m · TRY: 10.5 m

Plant height max10 m

Plant height min1.5 m

Seed length19 mm

Seed mass1 344 mg

Seed mass max1 509 mg

Seed mass min1 157 mg

Seed volume1 800 mm³

Seed volume max1 800 mm³

Seed volume min1 800 mm³

Life cycle & reproduction3

Deciduousnessevergreen

⚠ sources differ — TRY: evergreen · GIFT: deciduous

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 450 m

Elevation min300 m

Epiphyteterrestrial

Growth formtree

Habitat GIFT(palm) woodland, wooded grassland, coastal thicket, thickets on rocky hills, dry forest margins

Woodinesswoody

Physiology & chemistry9

Leaf C:N ratio24.42 g/g

Leaf c462 mg/g

Leaf dry-matter content (LDMC)385 mg/g

Leaf n19.13 mg/g

Leaf p0.7 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)9.65 mm²/mg

Wood density719 mg/cm³

03Chemical composition9 compounds

Compounds documented for Strychnos madagascariensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavonols3

Corynanthe type1

Secoiridoid monoterpenoids1

Stigmastane steroids1

Pyrazine and Piperazine alkaloids1

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2S,3R)-1-[6-[(2R,3S)-2,3,4-trihydroxybutyl]pyrazin-2-yl]butane-1,2,3,4-tetrol	present	NPASS
(1R,4E,6S,7R,17R)-4-ethylidene-7-hydroxy-6,7-dimethyl-2,9-dioxa-14-azatricyclo[9.5.1.014,17]heptadec-11-ene-3,8-dione	present	NPASS
(2R)-N-[(Z,2S,3S,4R)-3,4-dihydroxy-1-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoctadec-10-en-2-yl]-2-hydroxytetracosanamide	present	NPASS
(3S,4R,4aS)-4-Ethenyl-3-(beta-D-glucopyranosyloxy)-3,4,4a,5,6,7-hexahydro-8H-pyrano(3,4-c)pyridin-8-one	present	LOTUS
5,7-dihydroxy-2-(4-hydroxyphenyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-2-yl]oxychromen-4-one	present	NPASS
[(2R,3S,4S,5R,6R)-6-[[(3S,8S,9S,10R,13R,14S,17R)-17-[(1R,4R)-4-ethyl-1,5-dimethyl-hexyl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-yl]oxy]-3,4,5-trihydroxy-tetrahydropyran-2-yl]methyl heptadecanoate	present	NPASS
Astragalin	present	NPASS
Kaempferol	present	NPASS
Tombozine	present	LOTUS

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Strychnos madagascariensis has left across the world's sequence archives.

At a glance

DNA specimens21

Marker genes6

GenBank sequences10

eDNA detections14

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMW381787.1 ↗246 bp

ACGT

TTTCGTCCGAGGACATTAGGCCTAGGGCACGTCTGCCTGGGCGTCACGCATCTCGTCGACCCCCCCACACGCCGACTCAGGCCGTGCGAG …

Strychnos madagascariensis voucher WMSMITS2.1 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL6★rbcLa★trnL-F★ITS3★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type1 588 records

Wild obs. + sensor486

Museum / vouchered1 036

Cultivated / captive66

Range

Area of Occupancy AOO3 068 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 303≤1 km 45≤10 km 25>10 km 7

380 georeferenced · 106 without coordinates

Open the mapobservation + sensor486

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 20≤1 km 7≤10 km 22

49 georeferenced · 987 without coordinates

Open the institutions mapphysical evidence1 036

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy2% within 1 km

≤1 km 1≤10 km 65

66 georeferenced

Open the mapnot free-living66

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 43 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	200
Saint Louis, US	143
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	82
Plocation not on record	72
Paris, FR	58
Kew, GB	52
Durban, ZA	39
MeiseBGlocation not on record	33
Instituto de Investigação Científica Tropicallocation not on record	32
Centre National de la Recherche Appliquée au Developement Rurallocation not on record	26
CJBGlocation not on record	24
Glocation not on record	22
WAGlocation not on record	14
Stockholm, SE	13
Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record	10
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	7
University of Stellenboschlocation not on record	4
CASlocation not on record	3
MAlocation not on record	3
Uppsala, SE	3
Eduardo Mondlane Universitylocation not on record	3
MSB-3054location not on record	2
Institute for Agricultural Research of Mozambiquelocation not on record	2
ASUlocation not on record	2
Edward O. Wilson Biodiversity Laboratory, Gorongosa NPlocation not on record	2
Dekalb, US	2
Arusha, TZ	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Clocation not on record	1
University of Bayreuthlocation not on record	1
Bronx, US	1
UJlocation not on record	1
Museo Entomologico de Leonlocation not on record	1
Elocation not on record	1
University of Alberta Museumslocation not on record	1
Botanic Gardenlocation not on record	1
Herbarium of the University of Neuchâtellocation not on record	1
Frankfurt am Main	1
EAlocation not on record	1
University of Johannesburglocation not on record	1
University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record	1
Kunming, CN	1
South Kensington, GB	1

43 institutions · 872 of 1 036 vouchered records shown · 162 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA14 detections

Where the DNA of Strychnos madagascariensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map2 countries0

Mixed deciduous woodland/riverine woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.7 °C 18.3–27.2

Seasonal swing summer↔winter6.80 °C

Max temp (day)26.7 °C 25.5–31.9

Min temp (night)14.7 °C 11.7–22.8

Precipitation34.5 mm/mo 17.1–218

Air humidity56.9 % 48.3–62.0

Moisture balance-71.9 mm/mo -98.6–46.7

Vapour deficit1,186 Pa 1,004–1,431

Wind speed2.20 m/s 1.80–3.00

Cloud cover16.3 % 11.9–58.1

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Strychnos madagascariensis

At a glance

Sources10 archives

Size & morphology10

Life cycle & reproduction3

Diet & foraging1

Habitat & environment9

Physiology & chemistry9

Compound class profile5 classes

Documented compounds9 total

At a glance

Record type1 588 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 43 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 588 records