Strychnos ignatii

Bergius · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Loganiaceae/Strychnos

At a glance

Occurrence records163

Data sources12

Biological traits17

DNA specimens7

eDNA detections4

Sources12 archives

Databases and archives Strychnos ignatii's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility163 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Chemical compositionLOTUS · NPASS35 compounds

Occurrence & distributionGBIF163 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 44

01Narrative

Strychnos ignatii is a tree in the family Loganiaceae, native to the Philippines, particularly in Catbalogan and parts of China. The plant was first described by the Moravian (Czech) Jesuit working in the Philippines, brother Georg Kamel who named its seeds "the beans of St. Ignatius", in honour of the founder of his religious order.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height20 m

Seed mass1 000 mg

Seed mass max1 000 mg

Seed mass min1 000 mg

Life cycle & reproduction3

Deciduousnessevergreen

Life formliana

Life spanperennial

Habitat & environment8

Climatewet tropical

Climberobligatory

Elevation max800 m

Elevation mean600 m

Elevation min400 m

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Climber

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Specific leaf area (SLA)17.42 mm²/mg

03Chemical composition35 compounds

Compounds documented for Strychnos ignatii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Aspidosperma-Iboga hybrid type (Vinca alkaloids) $ Strychnos type8

Strychnos type6

Iridoids monoterpenoids3

Corynanthe type3

Cinnamic acids and derivatives1

Documented compounds35 total

Tissue Source Quantified only

Compound	Amount	Source
(19E)-4-methylsarpagan-4-ium-17-ol	present	LOTUS
(4aR,5aR,8aS,13aS,15bR)-5a-hydroxy-2,4a,5,7,8,13a,15,15a,15b,16-decahydro4,6-methanoindolo[3,2,1-ij]oxepino[2,3,4-de]pyrrolo[2,3-h]quinolin-14-one	present	LOTUS
(4aR,5aS,8aR,15bR)-10,11-dimethoxy-4a,5,5a,7,8,13a,15,15a,15b,16-decahydro-2H-4,6-methanoindolo[3,2,1-ij]oxepino[2,3,4-de]pyrrolo[2,3-h]quinoline-14-one	present	NPASS
(4Ar,5As,8Ar,15Br)-4A,5,5A,7,8,13A,15,15A,15B,16-Decahydro-2H-4,6-Methanoindolo[3,2,1-Ij]Oxepino[2,3,4-De]Pyrrolo[2,3-H]Quinoline-14-One	present	NPASS
10-Hydroxystrychnin	present	LOTUS
2-(3-ethylidene-2,4,6,7,12,12b-hexahydro-1H-indolo[2,3-a]quinolizin-2-yl)ethanol	present	LOTUS
4-Methoxystyrene	present	NPASS
[(1S,13S,14S,15E,17R)-15-Ethylidene-17-methyl-3-aza-17-azoniapentacyclo[12.3.1.02,10.04,9.012,17]octadeca-2(10),4,6,8-tetraen-13-yl]methanol	present	LOTUS
ADTDBAKUQAKBGZ-IQJCHXDOSA-N	present	NPASS
AMBQHHVBBHTQBF-SQSCWSLKSA-N	present	NPASS

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Strychnos ignatii has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences10

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOP850816.1 ↗430 bpViet Nam · 2021

ACGT

AGTTGCGCCCGAAGCCGTTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCTCCCCCCACACGCCCGCTCGGGCCGTGCG …

Strychnos ignatii strain Plant 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS6★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Strychnos ignatii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 441×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — GADELLA, Th. w. J. 1967. Some cytological observations in the Loganiaceae IV. Proc. Roy. Neth. Acad. Sci. Ser. C. 70: 302-304.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type163 records

Wild obs. + sensor1

Museum / vouchered162

Range

Area of Occupancy AOO388 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 161 without coordinates

Open the institutions mapphysical evidence162

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Guangzhou, CN	10
Beijing, CN	7
Cibinong Science Center, Herbarium Bogorienselocation not on record	5
Paris, FR	4
Kew, GB	3
Kunming, CN	2
Guilin, CN	2
Edinburgh, GB	2
Siouxland Heritage Museumlocation not on record	2
Cincinnati, US	1
Saint Louis, US	1
Nanjing, CN	1
University of Stellenboschlocation not on record	1
LDlocation not on record	1
South Kensington, GB	1
Yunnan Universitylocation not on record	1

16 institutions · 44 of 162 vouchered records shown · 117 without an institution code

09Environmental DNA4 detections

Where the DNA of Strychnos ignatii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.1 °C 26.3–27.9

Seasonal swing summer↔winter2.80 °C

Max temp (day)30.7 °C 29.7–31.7

Min temp (night)23.1 °C 22.7–23.5

Precipitation203 mm/mo 150–256

Air humidity64.0 % 60.6–67.3

Moisture balance62.0 mm/mo 5.30–119

Vapour deficit1,301 Pa 1,124–1,479

Wind speed1.70 m/s 1.30–2.10

Cloud cover48.1 % 40.5–55.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)