Strychnos icaja

Baill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Loganiaceae/Strychnos

At a glance

Occurrence records297

Data sources11

Biological traits13

DNA specimens1

eDNA detections10

Sources11 archives

Databases and archives Strychnos icaja's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility297 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS · NPASS74 compounds

Occurrence & distributionGBIF297 records

Environmental DNA2 datasets · 2 countries10 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 44

01Narrative

Strychnos icaja is a species belonging to the plant family Loganiaceae, native to West Tropical Africa. It is a very large, tropical rainforest liana which may attain a length of 100 m.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height35 m

Life cycle & reproduction3

Life formliana

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberobligatory

Epiphyteterrestrial

Growth formclimber

Habitat GIFTprimary forest

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition74 compounds

Compounds documented for Strychnos icaja across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Strychnos type51

Aspidosperma-Iboga hybrid type (Vinca alkaloids) $ Strychnos type18

Aspidosperma-Iboga hybrid type (Vinca alkaloids)7

Corynanthe type $ Strychnos type6

Arteminisin1

Documented compounds74 total

Tissue Source Quantified only

Compound	Amount	Source
(18alpha)-18-[(3aR,11aS,11bS,12R,13aS,14E)-14-(2-hydroxyethylidene)-9-oxo-2,3,11a,12,13,13a-hexahydro-9H,11bH-1,12-ethanopyrido[1,2,3-lm]pyrrolo[2,3-d]carbazol-10-yl]strychnidin-10-one	present	LOTUS
(1R,12S,13R,14E,19S,21S)-10-[(1R,12S,13R,14E,17R,19S,21S)-14-ethylidene-9-oxo-8,16-diazahexacyclo[11.5.2.11,8.02,7.016,19.012,21]henicosa-2,4,6,10-tetraen-17-yl]-14-(2-hydroxyethylidene)-8,16-diazahexacyclo[11.5.2.11,8.02,7.016,19.012,21]henicosa-2,4,6,10-tetraen-9-one	present	LOTUS
(1R,12S,13R,14E,19S,21S)-10-[(1R,13S,14E,17R,19S,21S)-14-ethylidene-9-oxo-8,16-diazahexacyclo[11.5.2.11,8.02,7.016,19.012,21]henicosa-2,4,6,11-tetraen-17-yl]-14-(2-hydroxyethylidene)-8,16-diazahexacyclo[11.5.2.11,8.02,7.016,19.012,21]henicosa-2,4,6,10-tetraen-9-one	present	LOTUS
(1R,12S,13R,14E,19S,21S)-14-ethylidene-10-[(1R,12S,13R,14E,17R,19S,21S)-14-ethylidene-9-oxo-8,16-diazahexacyclo[11.5.2.11,8.02,7.016,19.012,21]henicosa-2,4,6,10-tetraen-17-yl]-8,16-diazahexacyclo[11.5.2.11,8.02,7.016,19.012,21]henicosa-2,4,6,10-tetraen-9-one	present	LOTUS
(1R,12S,13R,14Z,19S,21S)-10-[(1R,11S,13S,15R,17R,27S,28Z,33S,35R,36R,38Z)-28,38-di(ethylidene)-8,14,24,30-tetrazaundecacyclo[25.5.2.211,14.11,26.110,17.02,7.013,17.018,23.030,33.08,35.024,36]octatriaconta-2,4,6,9,18,20,22,25-octaen-15-yl]-14-ethylidene-8,16-diazahexacyclo[11.5.2.11,8.02,7.016,19.012,21]henicosa-2,4,6,10-tetraen-9-one	present	LOTUS
(1R,12S,13R,14Z,19S,21S)-10-[(1R,12S,13R,14Z,17R,19S,21S)-14-ethylidene-9-oxo-8,16-diazahexacyclo[11.5.2.11,8.02,7.016,19.012,21]henicosa-2,4,6,10-tetraen-17-yl]-14-(2-hydroxyethylidene)-8,16-diazahexacyclo[11.5.2.11,8.02,7.016,19.012,21]henicosa-2,4,6,10-tetraen-9-one	present	LOTUS
(1R,12S,13R,14Z,19S,21S)-10-[(1R,9Z,11S,13S,15R,17R,25Z,27S,28E,33S,35R,36R,38Z)-28,38-di(ethylidene)-8,14,24,30-tetrazaundecacyclo[25.5.2.211,14.11,26.110,17.02,7.013,17.018,23.030,33.08,35.024,36]octatriaconta-2,4,6,9,18,20,22,25-octaen-15-yl]-14-ethylidene-8,16-diazahexacyclo[11.5.2.11,8.02,7.016,19.012,21]henicosa-2,4,6,10-tetraen-9-one	present	LOTUS
(1R,12S,13R,14Z,19S,21S)-10-[(1R,9Z,11S,13S,15R,17R,25Z,27S,28Z,33S,35S,36S,38Z)-28,38-di(ethylidene)-8,14,24,30-tetrazaundecacyclo[25.5.2.211,14.11,26.110,17.02,7.013,17.018,23.030,33.08,35.024,36]octatriaconta-2,4,6,9,18,20,22,25-octaen-15-yl]-14-ethylidene-8,16-diazahexacyclo[11.5.2.11,8.02,7.016,19.012,21]henicosa-2,4,6,10-tetraen-9-one	present	LOTUS
(1R,13R,14E,19S,21S)-14-ethylidene-10-[(1R,12S,13R,14E,17R,19S,21S)-14-ethylidene-9-oxo-8,16-diazahexacyclo[11.5.2.11,8.02,7.016,19.012,21]henicosa-2,4,6,10-tetraen-17-yl]-8,16-diazahexacyclo[11.5.2.11,8.02,7.016,19.012,21]henicosa-2,4,6,10-tetraen-9-one	present	LOTUS
(1R,13S,14E,19S,21S)-14-ethylidene-10-[(1R,12S,13R,14E,17R,19S,21S)-14-ethylidene-9-oxo-8,16-diazahexacyclo[11.5.2.11,8.02,7.016,19.012,21]henicosa-2,4,6,10-tetraen-17-yl]-8,16-diazahexacyclo[11.5.2.11,8.02,7.016,19.012,21]henicosa-2,4,6,11-tetraen-9-one	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Strychnos icaja has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections10

Countries2

The DNA barcodea real sequence read deposited for this species

ITSJF938044.1 ↗566 bp

ACGT

ACGAATCCTGCAGACGACCCGCGAACTCGTTTTTCTCCACGGGCGCCGCGAGGGGGCAACCTCGTCTCGGCCTCGTTCTGCGAGCGGCCA …

Strychnos icaja voucher J. Wierenga 2012 (WAG) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Strychnos icaja carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidypolyploid inferred

Chromosome records44–442n range44median44mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 442×CCDB · book-fedorov · CCDB · Cave1963

CCDB · book-fedorov — Gadella 1963b

CCDB · Cave1963 — Gadella 1963a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type297 records

Wild obs. + sensor2

Museum / vouchered293

Other2

Range

Area of Occupancy AOO428 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 293 records without

Open the institutions mapphysical evidence293

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MeiseBGlocation not on record	18
WAGlocation not on record	17
Yaoundé, CM	16
Saint Louis, US	14
LBVlocation not on record	10
Kew, GB	10
Plocation not on record	7
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	6
Herbier National du Gabonlocation not on record	5
CNF-UFHBlocation not on record	3
Elocation not on record	2
Bronx, US	2
BRLUlocation not on record	2
Cambridge, US	1
Leiden University Medical Centerlocation not on record	1
Pretoria, ZA	1
Budapest, HU	1
Centre National de Floristique - Université Félix HOUPHOUËT-BOIGNYlocation not on record	1
Limbe Botanical & Zoological Gardenslocation not on record	1
Berlin, DE	1
IPHAMETRAlocation not on record	1
Mlocation not on record	1
University of Stellenboschlocation not on record	1
Martin-Luther-Universität Halle-Wittenberglocation not on record	1
Chongqing Museumlocation not on record	1
Llocation not on record	1
Ulocation not on record	1
FIlocation not on record	1
Botanic Gardenlocation not on record	1
Coimbra, PT	1
University of Oxfordlocation not on record	1
MAlocation not on record	1
Glocation not on record	1
IFANlocation not on record	1

34 institutions · 133 of 293 vouchered records shown · 160 without an institution code

09Environmental DNA10 detections

Where the DNA of Strychnos icaja was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.8 °C 23.1–23.8

Seasonal swing summer↔winter1.70 °C

Max temp (day)28.0 °C 27.5–28.0

Min temp (night)21.2 °C 20.3–21.2

Precipitation172 mm/mo 172–185

Air humidity70.8 % 69.9–70.8

Moisture balance49.7 mm/mo 49.7–62.0

Vapour deficit855 Pa 847–855

Wind speed0.8 m/s 0.8–1.00

Cloud cover57.1 % 57.1–60.4

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)