Strychnos cocculoides

Baker · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Loganiaceae/Strychnos

At a glance

Occurrence records403

Data sources12

Biological traits25

DNA specimens5

eDNA detections4

Sources12 archives

Databases and archives Strychnos cocculoides's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility403 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Chemical compositionLOTUS · NPASS24 compounds

Occurrence & distributionGBIF403 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 44

01Narrative

Strychnos cocculoides là một loài thực vật có hoa trong họ Mã tiền. Loài này được Baker mô tả khoa học đầu tiên năm 1895.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height8 m

⚠ sources differ — GIFT: 8 m · TRY: 3.83 m

Plant height max6 m

Plant height min1 m

Seed mass484 mg

Seed mass max600 mg

Seed mass min364 mg

Life cycle & reproduction5

Deciduousnessdeciduous

Dispersal typeanimal

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 675 m

Elevation min795 m

Epiphyteterrestrial

Growth formtree

Habitat GIFTforest

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density646 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition24 compounds

Compounds documented for Strychnos cocculoides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Pyridine alkaloids3

Iridoids monoterpenoids2

Iridoids monoterpenoids $ Secoiridoid monoterpenoids2

Flavanones2

Aspidosperma type $ Strychnos type1

Documented compounds24 total

Tissue Source Quantified only

Compound	Amount	Source
(2R)-2-(2-phenylethyl)-2,3-dihydrochromen-4-one	present	NPASS
(2R,3S,4S,5R,6S)-2-[[(2S,3R,4S)-3-hydroxy-4-(hydroxymethyl)-4-methyloxolan-2-yl]oxymethyl]-6-(3,4,5-trimethoxyphenoxy)oxane-3,4,5-triol	present	LOTUS
(6S,7R)-6-hydroxy-7-methyl-2,3,4,5,6,7-hexahydro-1H-cyclopenta[c]pyridine-4-carboxylic acid	present	LOTUS
(7Alpha-Hydroxy)-Morroniside	present	LOTUS
1,5-Diphenylpentan-3-ol	present	NPASS
11-Methoxy-henningsamine	present	LOTUS
11-Methoxydiaboline	present	LOTUS
2-hydroxy-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)tetrahydropyran-2-yl]oxy-benzoic acid	present	LOTUS
8-Methoxy-2-(2-phenylethyl)-4H-1-benzopyran-4-one	present	NPASS
beta-Sitosterol	present	NPASS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Strychnos cocculoides has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes5

GenBank sequences8

eDNA detections4

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMW380872.1 ↗281 bpBotswana · 2019

ACGT

GTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGACCCC …

Strychnos cocculoides voucher WMSCITS2.1 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★rbcLa★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Strychnos cocculoides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 441×CCDB · book-ipcn72

CCDB · book-ipcn72 — GADELLA, T.W.J. 1972. Cytological studies on some flowering plants collected in Africa. Bull. Jard. Bot. Nat. Belg. 42: 393-402.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type403 records

Wild obs. + sensor143

Museum / vouchered246

Cultivated / captive14

Range

Area of Occupancy AOO968 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 61≤1 km 14≤10 km 5>10 km 2

82 georeferenced · 61 without coordinates

Open the mapobservation + sensor143

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy12% within 1 km

≤1 km 2≤10 km 5>10 km 10

17 georeferenced · 229 without coordinates

Open the institutions mapphysical evidence246

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy50% within 1 km

≤1 km 7≤10 km 7

14 georeferenced

Open the mapnot free-living14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	69
Saint Louis, US	27
MeiseBGlocation not on record	26
Kew, GB	14
Dresden, DE	8
Instituto de Investigação Científica Tropicallocation not on record	7
Durban, ZA	6
Adam Mickiewicz University in Poznańlocation not on record	5
WAGlocation not on record	5
TAFORI-LSRClocation not on record	3
Paris, FR	3
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	2
MAlocation not on record	2
LBVlocation not on record	2
South Kensington, GB	2
Plocation not on record	1
Ulocation not on record	1
DSMlocation not on record	1
Zürich, CH	1
EAlocation not on record	1
National Natural History Collectionslocation not on record	1
Arusha, TZ	1
Glocation not on record	1
Elocation not on record	1
Herbier National du Gabonlocation not on record	1
Clocation not on record	1
KwaZulu-Natal Herbariumlocation not on record	1

27 institutions · 193 of 246 vouchered records shown · 51 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Strychnos cocculoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.6 °C 18.9–21.5

Seasonal swing summer↔winter11.5 °C

Max temp (day)26.6 °C 26.5–27.9

Min temp (night)12.5 °C 11.9–14.3

Precipitation34.5 mm/mo 30.9–48.1

Air humidity48.3 % 46.1–50.2

Moisture balance-106 mm/mo -114–-100

Vapour deficit1,264 Pa 1,201–1,296

Wind speed2.90 m/s 2.60–3.40

Cloud cover16.3 % 15.7–26.6

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)