Strychnos camptoneura

Gilg & Busse · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Loganiaceae/Strychnos

At a glance

Occurrence records416

Data sources8

Biological traits14

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Strychnos camptoneura's data was compiled from.

GBIFGlobal Biodiversity Information Facility416 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources14 traits

Chemical compositionNPASS43 compounds

Occurrence & distributionGBIF416 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 44

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height40 m

Life cycle & reproduction3

Life formliana

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberobligatory

Epiphyteterrestrial

Growth formclimber

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits2

Fruiting endJul

Fruiting startJul

03Chemical composition43 compounds

Compounds documented for Strychnos camptoneura across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavones15

Labdane diterpenoids5

Labdane diterpenoids $ Norlabdane diterpenoids2

Cinnamic acids and derivatives $ Phenylethanoids2

Hydrocarbons1

Documented compounds43 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2S,3R,4R,5R)-3,4-dihydroxy-5-methyl-2-propan-2-ylcyclohexane-1-carboxylic acid	present	NPASS
(1R,3R,4R,4aS,8S,8aR)-4-[2-(furan-3-yl)ethyl]-8-(hydroxymethyl)-3,4a,8-trimethyl-2,3,5,6,7,8a-hexahydro-1H-naphthalene-1,4-diol	present	NPASS
(1R,3S,4R,4aS,8S,8aS)-4-[2-(furan-3-yl)ethyl]-8-(hydroxymethyl)-3,4a,8-trimethyl-2,3,5,6,7,8a-hexahydro-1H-naphthalene-1,4-diol	present	NPASS
(1R,4S,8S,9R,10S,12R)-9-[2-(furan-3-yl)ethyl]-9-hydroxy-4,8,10-trimethyl-2-oxatricyclo[6.3.1.04,12]dodecan-3-one	present	NPASS
(2'R,2''aS,5''aS,6''R,7''R,8''aR,8''bR)-3',3'',4',4'',5'',5''a,7'',8'',8''a,8''b-Decahydro-2''a,5''a,7''-trimethyldispiro(furan-3(2H),2'(5'H)-furan-5',6''-(6H)naphtho(1,8-bc)furan)-2''(2''aH)-one	present	NPASS
(E)-2-[(7R,9S)-9-Hydroxy-4-methyl-4,10-diazatetracyclo[8.6.1.05,17.011,16]heptadeca-1(17),11,13,15-tetraen-7-yl]but-2-enal	present	NPASS
[(2R)-1-[2-(3,4-dihydroxyphenyl)-5-hydroxy-4-oxochromen-7-yl]oxy-1-oxopropan-2-yl] (2S,3S,4S,5R,6R)-3,4,5,6-tetrahydroxyoxane-2-carboxylate	present	NPASS
[(2R)-1-[5-hydroxy-2-(4-hydroxyphenyl)-4-oxochromen-7-yl]oxy-1-oxopropan-2-yl] (2S,3S,4S,5R,6R)-3,4,5,6-tetrahydroxyoxane-2-carboxylate	present	NPASS
[(2R,3S,4R,5S,6S)-6-[2-(3,4-dihydroxyphenyl)ethoxy]-5-hydroxy-2-(hydroxymethyl)-4-[(2S,3R,4R,5S,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-3-yl] (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate	present	NPASS
[2-(3,4-dihydroxyphenyl)-5-hydroxy-4-oxochromen-7-yl] (2R)-2-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxypropanoate	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Strychnos camptoneura has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSJF937958.1 ↗593 bp

ACGT

ACGAATCCTGCAACGACCCGCGAACTCGTTTCTTTCCCGCGGGCGTCGGGAGGGGGAGACCCCGTCCCGGCACCGCTCCGCGAGCGGCCG …

Strychnos camptoneura voucher F. J. Breteler 13093 (WAG) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Strychnos camptoneura carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 441×CCDB · Cave1963

CCDB · Cave1963 — Gadella 1963a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type416 records

Wild obs. + sensor12

Museum / vouchered404

Range

Area of Occupancy AOO420 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 12 records without

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 403 without coordinates

Open the institutions mapphysical evidence404

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 44 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Yaoundé, CM	35
WAGlocation not on record	21
Saint Louis, US	18
Kew, GB	14
MeiseBGlocation not on record	13
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	8
Plocation not on record	8
CNF-UFHBlocation not on record	8
Bronx, US	4
Berlin, DE	4
University of Hamburglocation not on record	4
Pretoria, ZA	3
LBVlocation not on record	3
Herbier National du Gabonlocation not on record	2
Ulocation not on record	2
Forestry Research Institute of Nigerialocation not on record	2
Paris, FR	2
Ministry of Natural Resourceslocation not on record	1
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	1
Montpellier, FR	1
Llocation not on record	1
AgroBioInstitutelocation not on record	1
Cambridge, US	1
BRLUlocation not on record	1
Mlocation not on record	1
Dublin, IE	1
South African Forestry Research Institutelocation not on record	1
University of Oxfordlocation not on record	1
Njala Universitylocation not on record	1
EAlocation not on record	1
Botanic Gardenlocation not on record	1
Uppsala, SE	1
LISClocation not on record	1
Calabar, NG	1
Chicago, US	1
LISUlocation not on record	1
University of Stellenboschlocation not on record	1
Pharmaceutical Society of Great Britainlocation not on record	1
Elocation not on record	1
Wlocation not on record	1
IFANlocation not on record	1
Coimbra, PT	1
GRAlocation not on record	1
Stockholm, SE	1

44 institutions · 178 of 404 vouchered records shown · 226 without an institution code

09Environmental DNA1 detections

Where the DNA of Strychnos camptoneura was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)