Stropharia pseudocyanea

(Desm.) Morgan · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Strophariaceae/Stropharia

At a glance

Occurrence records2 364

Data sources8

Biological traits0

DNA specimens7

eDNA detections8

Sources8 archives

Databases and archives Stropharia pseudocyanea's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility2 364 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 364 records

Environmental DNA3 datasets · 3 countries8 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

Stropharia pseudocyanea is a mushroom in the family Strophariaceae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stropharia pseudocyanea has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes1

GenBank sequences2

eDNA detections8

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPQ644320.1 ↗682 bpUSA · 2023

ACGT

GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATGAACTTGGCTTGGTTGTTGCTGGCTTCTTAGGAAGTATGT …

Stropharia pseudocyanea isolate OMDL iNat # 194317358 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

08Occurrence & distribution

Record type2 364 records

Wild obs. + sensor2 044

Museum / vouchered312

Other8

Range

Area of Occupancy AOO6 640 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 666≤1 km 352≤10 km 839>10 km 57

1 914 georeferenced · 130 without coordinates

Open the mapobservation + sensor2 044

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 90≤1 km 73≤10 km 21>10 km 13

197 georeferenced · 115 without coordinates

Open the institutions mapphysical evidence312

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	66
TROMlocation not on record	22
	22
Kew, GB	21
Helsinki, FI	19
Trondheim, NO	17
Oulu, FI	14
WU-MYClocation not on record	14
Uppsala, SE	13
Copenhagen, DK	9
Joensuu, FI	9
SLU Artdatabankenlocation not on record	8
IB FRC Komi SC UB RASlocation not on record	6
Karlsruhe, DE	5
Göteborg, SE	5
Vancouver, CA	4
Turku, FI	3
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	3
LDlocation not on record	2
BDBClocation not on record	2
San Sebastián, ES	2
Philadelphia, US	2
Universidade de Lisboa, Museu Bocagelocation not on record	2
Metsähallituslocation not on record	1
JA-CAGPDS-CAMlocation not on record	1
Leicester, GB	1
Tartu, EE	1
Görlitz, DE	1
Salzburg, AT	1
Adam Mickiewicz University in Poznańlocation not on record	1
University of Oslo, Natural History Museumlocation not on record	1
MAlocation not on record	1

32 institutions · 279 of 312 vouchered records shown · 33 without an institution code

09Environmental DNA8 detections

Where the DNA of Stropharia pseudocyanea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys3

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map3 countries0

I sÃ¸lvbunketue i naturbeitemarkFjellbjork, fuktig fet jord, naer elv

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.6 °C 6.30–13.7

Seasonal swing summer↔winter20.9 °C

Max temp (day)12.2 °C 8.80–16.7

Min temp (night)7.70 °C 3.00–9.20

Precipitation139 mm/mo 76.2–230

Air humidity64.6 % 61.2–67.4

Moisture balance69.2 mm/mo -4.90–165

Vapour deficit459 Pa 315–611

Wind speed3.30 m/s 3.10–4.40

Cloud cover47.9 % 41.0–62.7

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Stropharia pseudocyanea

At a glance

Sources8 archives

At a glance

Record type2 364 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions18 of 32 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 364 records