Stropharia inuncta

(Fr.) Quél. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Strophariaceae/Stropharia

At a glance

Occurrence records1 483

Data sources9

Biological traits0

DNA specimens6

eDNA detections22

Sources9 archives

Databases and archives Stropharia inuncta's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 483 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 483 records

Environmental DNA4 datasets · 7 countries22 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Stropharia inuncta is a species of mushroom native to Europe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stropharia inuncta has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes1

GenBank sequences3

eDNA detections22

Countries7

The DNA barcodea real sequence read deposited for this species

ITSEU784418.1 ↗648 bp

ACGT

GCGGAAGGGATCATTATTGAATGAACTTGGCTTGGTTGTTGCTGGCCTCTTTGGAGGTATGTGCACACCTTGTCATCTTTATATCTCCAC …

Stropharia inuncta voucher RBG Kew K(M)125550 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

08Occurrence & distribution

Record type1 483 records

Wild obs. + sensor1 259

Museum / vouchered223

Other1

Range

Area of Occupancy AOO4 032 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 212≤1 km 92≤10 km 848>10 km 62

1 214 georeferenced · 45 without coordinates

Open the mapobservation + sensor1 259

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 14≤1 km 36≤10 km 28>10 km 6

84 georeferenced · 139 without coordinates

Open the institutions mapphysical evidence223

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	27
WU-MYClocation not on record	12
MeiseBGlocation not on record	10
SLU Artdatabankenlocation not on record	8
Göteborg, SE	7
Copenhagen, DK	7
Olocation not on record	7
Uppsala, SE	6
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	5
Karlsruhe, DE	5
Trondheim, NO	5
Helsinki, FI	4
Görlitz, DE	3
University of Oslo, Natural History Museumlocation not on record	3
nsnflocation not on record	3
Adam Mickiewicz University in Poznańlocation not on record	3
WTUlocation not on record	2
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
BDBClocation not on record	2
Joensuu, FI	1
TROMlocation not on record	1
Tartu, EE	1
Turku, FI	1
Gijón, ES	1
MUSE - Museo delle Scienze di Trentolocation not on record	1
Vancouver, CA	1
Zürich, CH	1
Catholic University of Pekinglocation not on record	1
CJBGlocation not on record	1
NTNU University Museum, Department of Natural Historylocation not on record	1

30 institutions · 132 of 223 vouchered records shown · 91 without an institution code

09Environmental DNA22 detections

Where the DNA of Stropharia inuncta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys4

Countries7

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map7 countries0

StrandengMoserik grasplenNA T32 Semi-naturlig eng

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 6.20–14.0

Seasonal swing summer↔winter22.9 °C

Max temp (day)14.6 °C 8.70–17.0

Min temp (night)8.20 °C 3.70–11.2

Precipitation81.2 mm/mo 67.6–118

Air humidity61.7 % 60.6–65.6

Moisture balance18.3 mm/mo 9.90–96.0

Vapour deficit482 Pa 317–614

Wind speed3.60 m/s 2.10–6.00

Cloud cover53.1 % 44.4–54.8

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Stropharia inuncta

At a glance

Sources9 archives

At a glance

Record type1 483 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 483 records