Stropharia cyanea

(Bull.) Tuomik. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Strophariaceae/Stropharia

At a glance

Occurrence records3 778

Data sources7

Biological traits0

DNA specimens2

eDNA detections6

Sources7 archives

Databases and archives Stropharia cyanea's data was compiled from.

GBIFGlobal Biodiversity Information Facility3 778 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF3 778 records

Environmental DNA3 datasets · 5 countries6 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stropharia cyanea has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences2

eDNA detections6

Countries5

The DNA barcodea real sequence read deposited for this species

ITSMZ567813.1 ↗277 bp

ACGT

TTATTGAATGAACTTGGCTTGGTTGTTGCTGGCTTCTTTGGAGGCATGTGCACACCTTGTCATCTTTATATCTCCACCTGTGCACCTCTT …

Stropharia cyanea clone SH2089175.08FU internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

08Occurrence & distribution

Record type3 778 records

Wild obs. + sensor3 465

Museum / vouchered309

Other4

Range

Area of Occupancy AOO9 028 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 2 146≤1 km 866≤10 km 395>10 km 3

3 410 georeferenced · 55 without coordinates

Open the mapobservation + sensor3 465

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 71≤1 km 81≤10 km 12>10 km 13

177 georeferenced · 132 without coordinates

Open the institutions mapphysical evidence309

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	84
Joensuu, FI	24
LDlocation not on record	24
Uppsala, SE	20
Adam Mickiewicz University in Poznańlocation not on record	14
MeiseBGlocation not on record	13
TROMlocation not on record	12
BDBClocation not on record	11
Trondheim, NO	11
SLU Artdatabankenlocation not on record	9
Philadelphia, US	9
Chicago, US	4
nsnflocation not on record	4
Kew, GB	3
Copenhagen, DK	3
Universidade de Lisboa, Museu Bocagelocation not on record	3
San Sebastián, ES	2
HabitatVisionlocation not on record	2
Warsaw, PL	2
University of Oslo, Natural History Museumlocation not on record	2
	2
University of the Basque Country (UPV/EHU)location not on record	2
WTUlocation not on record	2
Université de Montréal Biodiversity Centrelocation not on record	2
Toronto, CA	1
TENN-Flocation not on record	1
PRClocation not on record	1
Stockholm, SE	1
Göteborg, SE	1
Jyväskylä, FI	1
Karlsruhe, DE	1
Charles University in Praguelocation not on record	1
Vitoria, ES	1
WU-MYClocation not on record	1

34 institutions · 274 of 309 vouchered records shown · 35 without an institution code

09Environmental DNA6 detections

Where the DNA of Stropharia cyanea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys3

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map5 countries0

PalearcticAfrotropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.4 °C 6.30–19.6

Seasonal swing summer↔winter18.7 °C

Max temp (day)13.7 °C 9.70–23.4

Min temp (night)8.20 °C 2.10–15.7

Precipitation113 mm/mo 73.1–194

Air humidity60.2 % 58.2–65.1

Moisture balance39.5 mm/mo -28.3–126

Vapour deficit572 Pa 345–931

Wind speed2.60 m/s 1.80–4.60

Cloud cover42.8 % 39.5–47.1

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Stropharia cyanea

At a glance

Sources7 archives

At a glance

Record type3 778 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 778 records