Stropharia albonitens

(Fr.) Quél. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Strophariaceae/Stropharia

At a glance

Occurrence records552

Data sources9

Biological traits0

DNA specimens5

eDNA detections6

Sources9 archives

Databases and archives Stropharia albonitens's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility552 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF552 records

Environmental DNA2 datasets · 2 countries6 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Stropharia albonitens is an inedible mushroom found in grassy fields, lawns, and frequently along roadsides in North America and Europe. The spore print is purplish to black. It is white to cream or yellow in colour. It is typically 5 to 15 cm long with a ring on its stem and grows from July to November. The spores are ellipsoid and range in measurement from . This species was published in Champs Jura Vosges 3: 439 (1875) and was originally named Agaricus albonitens in 1857 by Elias Magnus Fries.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stropharia albonitens has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes1

GenBank sequences1

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOM665317.1 ↗625 bpUnited Kingdom · 2021

ACGT

GTAGGTGAACCTGCGGAAGGATCATTATTGAATGAACTTGGCTTGGTTGTTGCTGGCTTCTTTGGAAGTATGTGCACACCTTGTCATCTT …

Stropharia albonitens voucher DJH21-64 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type552 records

Wild obs. + sensor339

Museum / vouchered213

Range

Area of Occupancy AOO1 700 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 187≤1 km 57≤10 km 56>10 km 6

306 georeferenced · 33 without coordinates

Open the mapobservation + sensor339

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 56≤1 km 63≤10 km 25>10 km 20

164 georeferenced · 49 without coordinates

Open the institutions mapphysical evidence213

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	61
Helsinki, FI	24
Uppsala, SE	15
Trondheim, NO	15
TROMlocation not on record	11
Göteborg, SE	7
WU-MYClocation not on record	7
Vancouver, CA	6
SLU Artdatabankenlocation not on record	6
Karlsruhe, DE	4
TENN-Flocation not on record	4
nsnflocation not on record	4
Kew, GB	4
Oulu, FI	3
Stockholm, SE	2
University of Oslo, Natural History Museumlocation not on record	2
Bernard Price Institute for Palaeontological Researchlocation not on record	2
WTUlocation not on record	2
Berlin, DE	1
FLASlocation not on record	1
Toronto, CA	1
US	1
Université de Montréal Biodiversity Centrelocation not on record	1
Joensuu, FI	1
Chicago, US	1
GJOlocation not on record	1
Denver, US	1
Turku, FI	1
Trondheim, NO	1
Madison, US	1
Universidade de Lisboa, Museu Bocagelocation not on record	1
Pullman, US	1
Chapel Hill, US	1
Catholic University of Pekinglocation not on record	1

34 institutions · 195 of 213 vouchered records shown · 18 without an institution code

09Environmental DNA6 detections

Where the DNA of Stropharia albonitens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

I sÃ¸lvbunketue, beitemark

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.2 °C 5.50–11.9

Seasonal swing summer↔winter19.2 °C

Max temp (day)12.0 °C 7.40–15.5

Min temp (night)6.20 °C 1.40–9.60

Precipitation136 mm/mo 94.2–187

Air humidity65.0 % 61.6–67.8

Moisture balance78.4 mm/mo 27.5–140

Vapour deficit427 Pa 304–538

Wind speed4.10 m/s 2.80–5.50

Cloud cover51.5 % 48.1–60.8

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)