Strophanthus preussii

Engl. & Pax · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Strophanthus

At a glance

Occurrence records517

Data sources12

Biological traits14

DNA specimens2

eDNA detections2

Sources12 archives

Databases and archives Strophanthus preussii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility517 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionNPASS12 compounds

Occurrence & distributionGBIF517 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Strophanthus preussii, the Preuss' strophanthus, is a plant in the dogbane family Apocynaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height10 m

Life cycle & reproduction5

Flowering endMar

Flowering startMar

Life formshrub or liana

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberobligatory

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Climber

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition12 compounds

Compounds documented for Strophanthus preussii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Flavonols6

Gallotannins2

Simple phenolic acids1

Documented compounds12 total

Tissue Source Quantified only

Compound	Amount	Source
1,2,6-Tri-O-Galloyl-Beta-D-Glucose	present	NPASS
2''-O-Galloylhyperin	present	NPASS
[(2S,3R,4S,5S)-2-[2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-4-oxochromen-3-yl]oxy-4,5-dihydroxyoxan-3-yl] 3,4,5-trihydroxybenzoate	present	NPASS
Afzelin	present	NPASS
Hyperin	present	NPASS
Kaempferol 3-alpha-L-arabinopyranoside	present	NPASS
Methyl gallate	present	NPASS
Penta-O-galloyl-beta-D-glucose	present	NPASS
QJPCKAJTLHDNCS-UHFFFAOYSA-N	present	NPASS
Quercetin -3-O-(2'',6''-O-Digalloyl)-Beta-D-Galactopyranoside	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Strophanthus preussii has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences4

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLKJ746500.1 ↗541 bpNigeria · 2013

ACGT

GTGTTGGATTCAAAGCCGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACTAAAGATACTGATATCTTAGCAGCAT …

Strophanthus preussii isolate DNAS-5A-59748 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Strophanthus preussii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 201×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type517 records

Wild obs. + sensor53

Museum / vouchered459

Other5

Range

Area of Occupancy AOO912 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 17≤1 km 5

22 georeferenced · 31 without coordinates

Open the mapobservation + sensor53

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤1 km 6≤10 km 4

10 georeferenced · 449 without coordinates

Open the institutions mapphysical evidence459

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MeiseBGlocation not on record	84
Saint Louis, US	44
WAGlocation not on record	25
Yaoundé, CM	23
Kew, GB	19
Forest Herbarium Ibadan (FHI)location not on record	16
HNBlocation not on record	12
Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record	8
Herbier National du Gabonlocation not on record	8
Plocation not on record	6
LBVlocation not on record	5
CNF-UFHBlocation not on record	5
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	4
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	4
University of Stellenboschlocation not on record	4
Dresden, DE	4
CJBGlocation not on record	3
Bronx, US	2
Paris, FR	2
Chongqing Museumlocation not on record	2
EFGlocation not on record	2
Stockholm, SE	2
Institut de Recherche Agronomique de Guinée (IRAG)location not on record	2
Fort Worth, US	2
Tampa, US	2
LSFlocation not on record	2
Riverside, US	1
MAlocation not on record	1
BMlocation not on record	1
Frankfurt am Main	1
Université du Lomélocation not on record	1
Santa Barbara, US	1
Philadelphia, US	1

33 institutions · 299 of 459 vouchered records shown · 159 without an institution code

09Environmental DNA2 detections

Where the DNA of Strophanthus preussii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

school campus

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.5 °C 26.5–26.5

Seasonal swing summer↔winter4.10 °C

Max temp (day)31.3 °C

Min temp (night)22.7 °C

Precipitation160 mm/mo

Air humidity60.9 %

Moisture balance20.1 mm/mo

Vapour deficit1,370 Pa

Wind speed1.90 m/s

Cloud cover27.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)