Strophanthus hispidus

A.DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Strophanthus

At a glance

Occurrence records638

Data sources13

Biological traits21

DNA specimens0

eDNA detections0

Sources13 archives

Databases and archives Strophanthus hispidus's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility638 records↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Chemical compositionDukesPhytochem · LOTUS · NPASS50 compounds

Occurrence & distributionGBIF638 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 18

01Narrative

Strophanthus hispidus, the hispid strophanthus, (family: Apocynaceae) is a liana or shrub that can grow up to 5 m tall. Its flowers feature a yellow corolla and yellow corona lobes spotted with red, purple or brown. The seeds, like those of several other Strophanthus species, contain potent cardiac glycosides (notably strophanthin) absorbable through wounds - hence its use in African arrow poisons and later in modern medicine as a digitalis-like heart stimulant. Strophanthus hispidus is native from west tropical Africa east to Tanzania and south to Angola. It is naturalized in China.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Leaf length125 mm

Leaf length max200 mm

Leaf length min50 mm

Leaf width max80 mm

Leaf width min25 mm

Plant height8.75 m

Plant height max3 m

Plant height min2 m

Life cycle & reproduction5

Deciduousnessevergreen

⚠ sources differ — TRY: evergreen · GIFT: deciduous

Dispersal typewind

Life formshrub or liana

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberobligatory

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Climber

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition50 compounds

Compounds documented for Strophanthus hispidus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

💊 Medicinal use documented

Compound class profile5 classes

Cardenolides9

Stigmastane steroids3

Flavones2

Pyranocoumarins $ Simple coumarins2

Cinnamic acids and derivatives $ Simple phenolic acids2

Documented compounds50 total

Tissue Source Quantified only

Compound	Amount	Source
FAT	320,000 ppm	DukesPhytochem
CYMARINE	14,700 ppm	DukesPhytochem
CYMARIN	10,000 ppm	DukesPhytochem
CYMAROL	6,500 ppm	DukesPhytochem
STROPHANTHIN	700 ppm	DukesPhytochem

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Strophanthus hispidus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

rbcLOP133565.1 ↗155 522 bp

ACGT

CGGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTTGATCCACTTGGCTACATCCGCCCCTTCACCCCTTC …

Strophanthus hispidus voucher C.F. Zhang 5975 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Strophanthus hispidus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–202n range19median18mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — Arends, J. & F. v. Laan. 1982. Somatic Chromosome Numbers in Anubias Schott. Aroideana 5(1): 3–7.

CCDB · eflora

2n 202×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — Delay

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type638 records

Wild obs. + sensor250

Museum / vouchered328

Other60

Range

Area of Occupancy AOO1 064 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 12≤1 km 4≤10 km 1

17 georeferenced · 233 without coordinates

Open the mapobservation + sensor250

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤1 km 1≤10 km 4>10 km 2

7 georeferenced · 321 without coordinates

Open the institutions mapphysical evidence328

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Yaoundé, CM	30
MeiseBGlocation not on record	29
Saint Louis, US	25
Kew, GB	17
LSF/FSA/UAClocation not on record	13
WAGlocation not on record	12
Université du Lomélocation not on record	11
HNBlocation not on record	11
Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record	8
Forest Herbarium Ibadan (FHI)location not on record	6
CNF-UFHBlocation not on record	6
Paris, FR	5
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	4
Frankfurt am Main	4
Stockholm, SE	4
Brussels, BE	3
Durban, ZA	3
MAlocation not on record	3
Leiden University Medical Centerlocation not on record	2
Herbier National du Gabonlocation not on record	2
Philadelphia, US	2
LSFlocation not on record	2
Bronx, US	2
Institut de Recherche Agronomique de Guinée (IRAG)location not on record	2
Beijing, CN	1
Guangzhou, CN	1
CJBGlocation not on record	1
University of Stellenboschlocation not on record	1
IFAN Ch. A. Dioplocation not on record	1
Centre National de Floristique - Université Félix HOUPHOUËT-BOIGNYlocation not on record	1
Plocation not on record	1
LBVlocation not on record	1
Yangling, CN	1
UJLOGlocation not on record	1

34 institutions · 216 of 328 vouchered records shown · 111 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)