Strophanthus gratus

(Wall. & Hook.) Baill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Strophanthus

At a glance

Occurrence records359

Data sources10

Biological traits20

DNA specimens2

eDNA detections1

Sources10 archives

Databases and archives Strophanthus gratus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility359 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Chemical compositionNPASS4 compounds

Occurrence & distributionGBIF359 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Strophanthus gratus is a plant in the dogbane family Apocynaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology7

Leaf length120 mm

Leaf length max150 mm

Leaf length min90 mm

Leaf width57.5 mm

Leaf width max75 mm

Leaf width min40 mm

Plant height20 m

Life cycle & reproduction5

Deciduousnessevergreen

Life formscrambling shrub or liana

Life spanperennial

Raunkiær life formphanerophyte

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climateseasonally dry tropical

Climberobligatory

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Climber

Habitat GIFTforest fringe and forest gap

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition4 compounds

Compounds documented for Strophanthus gratus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Cardenolides2

Cycloartane triterpenoids1

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,3R,4S,5S,6R)-2-[[(1S,3R,6S,7S,8R,10S,11S,12S,15R,16R)-6,10-dihydroxy-15-[(2R,5R)-6-hydroxy-6-methyl-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyheptan-2-yl]-7,12,16-trimethyl-7-pentacyclo[9.7.0.01,3.03,8.012,16]octadecanyl]methoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
4-[3A,5A,9,10-Tetrahydroxy-9A-(hydroxymethyl)-11A-methyl-7-[(3,4,5-trihydroxy-6-methyloxan-2-YL)oxy]-hexadecahydro-1H-cyclopenta[A]phenanthren-1-YL]-2,5-dihydrofuran-2-one	present	NPASS
FHIREUBIEIPPMC-MKDJAOMVSA-N	present	NPASS
Ouabain	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Strophanthus gratus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMN366527.1 ↗528 bp

ACGT

GTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACTAAAGATACTGATATCTTAGCAGCATTCCGAGTAACTCCTCAACCC …

Strophanthus gratus voucher IDRCG759-13_FHO_PS4197 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Strophanthus gratus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–202n range19median18mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — Arends, J. & F. v. Laan. 1982. Somatic Chromosome Numbers in Anubias Schott. Aroideana 5(1): 3–7.

CCDB · eflora

2n 202×CCDB · book-indian_vol1 · CCDB · book-atlas-flowering-plants

CCDB · book-indian_vol1 — Witkus, E.R. 1951 ; Tapadar, N.N. Roy & Sen, N.K. 1960a, b ; Mangenot, S. & Mangenot, G. 1962 ; Tapadar, N. N.!Roy 1964a

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type359 records

Wild obs. + sensor63

Museum / vouchered296

Range

Area of Occupancy AOO680 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 25≤1 km 10≤10 km 2>10 km 10

47 georeferenced · 16 without coordinates

Open the mapobservation + sensor63

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤1 km 6>10 km 2

8 georeferenced · 288 without coordinates

Open the institutions mapphysical evidence296

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Yaoundé, CM	51
Saint Louis, US	34
WAGlocation not on record	19
LBVlocation not on record	9
Herbier National du Gabonlocation not on record	8
Plocation not on record	7
Kew, GB	6
University of Stellenboschlocation not on record	4
Paris, FR	4
BRLUlocation not on record	4
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	3
St. Augustine, TT	3
Forest Herbarium Ibadan (FHI)location not on record	2
Baroda, IN	2
IPHAMETRAlocation not on record	2
Miami, US	2
Denver, US	2
EL PASO, US	1
Philadelphia, US	1
HNBlocation not on record	1
Brussels, BE	1
MAlocation not on record	1
Institut de Recherche Agronomique de Guinée (IRAG)location not on record	1
Claremont, US	1
CJBGlocation not on record	1
Pondicherry, IN	1
TAFORI-LSRClocation not on record	1
Daubeny Herbarium, Oxfordlocation not on record	1
Phoenix, US	1
UJLOGlocation not on record	1
St. Paul, US	1
Gump Stationlocation not on record	1
Fort Worth, US	1
Chaguaramas, TT	1

34 institutions · 179 of 296 vouchered records shown · 117 without an institution code

09Environmental DNA1 detections

Where the DNA of Strophanthus gratus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 24.1–24.1

Seasonal swing summer↔winter2.90 °C

Max temp (day)28.4 °C

Min temp (night)20.6 °C

Precipitation85.9 mm/mo

Air humidity67.9 %

Moisture balance-30.3 mm/mo

Vapour deficit962 Pa

Wind speed0.9 m/s

Cloud cover25.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)