Strophanthus courmontii

Sacleux ex Franch. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Strophanthus

At a glance

Occurrence records68

Data sources10

Biological traits13

DNA specimens4

eDNA detections2

Sources10 archives

Databases and archives Strophanthus courmontii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility68 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS · NPASS6 compounds

Occurrence & distributionGBIF68 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Strophanthus courmontii grows as a deciduous liana up to 22 m long or as a shrub up to 4 m tall, with a stem diameter up to 10 cm. Its fragrant flowers feature a white turning red and purple corolla tube, yellow with purple streaks inside. Habitats are forests and riverine thickets, from sea level to 1400 m altitude. S. courmontii is used in local medicinal treatments for rheumatism and as an aphrodisiac. The plant is native to Kenya, Tanzania, Malawi, Mozambique, Zambia and Zimbabwe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height12.5 m

Life cycle & reproduction3

Deciduousnessdeciduous

Life formclimber

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Climberobligatory

Epiphyteterrestrial

Growth formclimber

Habitat GIFTdry forest or riverine forest

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition6 compounds

Compounds documented for Strophanthus courmontii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Quinolizidine alkaloids4

Cardenolides2

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
(7S,7aS,14S,14aR)-1,7,7a,8,9,10,11,13,14,14a-Decahydro-7,14-methano-2H,6H-dipyrido(1,2-a:1',2'-e)(1,5)diazocin-2-one	present	NPASS
[(1S,2S,4S,9S,10R)-14-oxo-7,15-diazatetracyclo[7.7.1.02,7.010,15]heptadecan-4-yl] 2-aminobenzoate	present	NPASS
Hydroxylupanine	present	NPASS
Sarmentocymarin	present	LOTUS
Sarmentogenin	present	LOTUS
trans-13-Cinnamoyloxylupanine	present	NPASS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Strophanthus courmontii has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKU568141.1 ↗552 bpMozambique · 2012

ACGT

AGTGTTGGATTCAAAGCCGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACTAAAGATACTGATATCTTAGCAGCA …

Strophanthus courmontii ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa

plant barcode

08Occurrence & distribution

Record type68 records

Wild obs. + sensor15

Museum / vouchered53

Range

Area of Occupancy AOO204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 12≤1 km 1≤10 km 1

14 georeferenced · 1 without coordinates

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 53 records without

Open the institutions mapphysical evidence53

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instituto de Investigação Científica Tropicallocation not on record	11
Saint Louis, US	9
TAFORI-LSRClocation not on record	8
Kew, GB	7
University of Johannesburglocation not on record	2
MeiseBGlocation not on record	2
Bronx, US	1
Taipei, TW	1
MAlocation not on record	1
University of Bayreuthlocation not on record	1
Miami, US	1
Chongqing Museumlocation not on record	1
UJlocation not on record	1
Fort Worth, US	1

14 institutions · 47 of 53 vouchered records shown · 6 without an institution code

09Environmental DNA2 detections

Where the DNA of Strophanthus courmontii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.2 °C 20.0–22.3

Seasonal swing summer↔winter6.20 °C

Max temp (day)26.3 °C 25.1–27.4

Min temp (night)16.2 °C 15.5–16.9

Precipitation14.9 mm/mo 4.10–25.6

Air humidity57.4 % 53.6–61.3

Moisture balance-78.1 mm/mo -100–-55.8

Vapour deficit1,082 Pa 911–1,252

Wind speed1.90 m/s 1.80–2.10

Cloud cover21.6 % 15.6–27.5

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)