Strophanthus caudatus

(L.) Kurz · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Strophanthus

At a glance

Occurrence records111

Data sources10

Biological traits21

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Strophanthus caudatus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility111 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Occurrence & distributionGBIF111 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Strophanthus caudatus is a woody liana that can grow up to 12 m in length, with a trunk diameter of up to 1.5 cm. It grows natively from Guangxi in southern China, through Indochina (including the Andaman and Nicobar Islands) to Malesia and New Guinea.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology10

Inflorescence length max15 cm

Inflorescence length min5 cm

Leaf length115 mm

Leaf length max170 mm

Leaf length min60 mm

Leaf width max85 mm

Leaf width min30 mm

Plant height6.75 m

Plant height max8 m

Plant height min3 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formclimbing shrub or liana

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Climber

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Strophanthus caudatus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences7

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMK304498.1 ↗434 bpSingapore · 2018

ACGT

CCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCTCCTTCTCA …

Strophanthus caudatus isolate 4 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Strophanthus caudatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records20–202n range20median20mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 203×CCDB · book-indian_vol1 · CCDB · eflora

CCDB · book-indian_vol1 — Tapadar, N.N. Roy 1964a; Sarkar, A. K. et al. 1973a

CCDB · book-indian_vol1 — Tapadar, N.N. Roy & Sen, N.K. 1960a, b

CCDB · eflora

n 101×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — SARKAR, A.K., N. DATTA., & U. CHATTERJEE. 1973. In IOPB chromosome number reports XLII. Taxon 22: 647-654.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type111 records

Wild obs. + sensor13

Museum / vouchered98

Range

Area of Occupancy AOO256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 5≤1 km 4>10 km 1

10 georeferenced · 3 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤1 km 3≤10 km 1

4 georeferenced · 94 without coordinates

Open the institutions mapphysical evidence98

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	4
Baroda, IN	3
BISHlocation not on record	2
Honolulu, US	2
Bronx, US	1
Pretoria, ZA	1
Philadelphia, US	1
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	1
Servico de Microbiologia e Imunologialocation not on record	1
Vietnam Academy of Science and Technology (VAST)location not on record	1
Cambridge, US	1
Pondicherry, IN	1
LDlocation not on record	1

13 institutions · 20 of 98 vouchered records shown · 78 without an institution code

09Environmental DNA1 detections

Where the DNA of Strophanthus caudatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)