Strophanthus boivinii

Baill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Strophanthus

At a glance

Occurrence records413

Data sources10

Biological traits17

DNA specimens3

eDNA detections3

Sources10 archives

Databases and archives Strophanthus boivinii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility413 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Chemical compositionLOTUS9 compounds

Occurrence & distributionGBIF413 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Strophanthus boivinii, the wood shaving flower, is a species of plant in the family Apocynaceae. The Latin specific epithet of boivinii refers to French explorer and plant collector Louis Hyacinthe Boivin (1808-1852).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height8 m

Seed mass7.67 mg

Seed mass max7.67 mg

Seed mass min7.67 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

03Chemical composition9 compounds

Compounds documented for Strophanthus boivinii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Cardenolides9

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
(3S,5S,8R,9S,10R,13R,14S,17R)-14-hydroxy-3-[(2R,4R,5S,6R)-4-methoxy-6-methyl-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-13-methyl-17-(5-oxo-2H-furan-3-yl)-1,2,3,4,5,6,7,8,9,11,12,15,16,17-tetradecahydrocyclopenta[a]phenanthrene-10-carbaldehyde	present	LOTUS
(3S,5S,8R,9S,10R,13R,14S,17R)-14-hydroxy-3-[(2R,4S,5R,6R)-4-hydroxy-6-methyl-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-13-methyl-17-(5-oxo-2H-furan-3-yl)-1,2,3,4,5,6,7,8,9,11,12,15,16,17-tetradecahydrocyclopenta[a]phenanthrene-10-carboxylic acid	present	LOTUS
3-[(3S,5S,8R,9S,10S,13R,14S,17S)-14-hydroxy-3-[(2R,4R,5S,6R)-4-methoxy-6-methyl-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-10,13-dimethyl-1,2,3,4,5,6,7,8,9,11,12,15,16,17-tetradecahydrocyclopenta[a]phenanthren-17-yl]-2H-furan-5-one	present	LOTUS
Boivinide A	present	LOTUS
Boivinide B	present	LOTUS
Boivinide C	present	LOTUS
Boivinide D	present	LOTUS
Boivinide E	present	LOTUS
Boivinide F	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Strophanthus boivinii has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences2

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLDQ660667.1 ↗1 279 bpSwitzerland

ACGT

TACTGATATCTTAGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCCGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTAC …

Strophanthus boivinii ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

08Occurrence & distribution

Record type413 records

Wild obs. + sensor84

Museum / vouchered329

Range

Area of Occupancy AOO632 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 51≤1 km 8≤10 km 6>10 km 4

69 georeferenced · 15 without coordinates

Open the mapobservation + sensor84

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 11≤1 km 3>10 km 1

15 georeferenced · 314 without coordinates

Open the institutions mapphysical evidence329

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	67
Paris, FR	65
Kew, GB	42
Plocation not on record	34
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	32
Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record	26
CJBGlocation not on record	13
Glocation not on record	7
Centre National de la Recherche Appliquée au Developement Rurallocation not on record	5
Stockholm, SE	3
MeiseBGlocation not on record	1
Frankfurt am Main	1
Miami, US	1
University of Stellenboschlocation not on record	1
Gujarat Biodiversity Gene Banklocation not on record	1
Pondicherry, IN	1
WAGlocation not on record	1
Fort Worth, US	1

18 institutions · 302 of 329 vouchered records shown · 25 without an institution code

09Environmental DNA3 detections

Where the DNA of Strophanthus boivinii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-2.50 °C -2.50–17.2

Seasonal swing summer↔winter19.1 °C

Max temp (day)0.9 °C 0.9–23.7

Min temp (night)-7.30 °C -7.30–10.3

Precipitation175 mm/mo 35.7–175

Air humidity60.2 % 47.4–60.2

Moisture balance118 mm/mo -70.5–118

Vapour deficit219 Pa 219–1,233

Wind speed6.90 m/s 3.50–6.90

Cloud cover46.7 % 22.1–46.7

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)