Stropenron hamata

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Elateridae/Stropenron

At a glance

Occurrence records79

Data sources4

Biological traits0

DNA specimens42

eDNA detections42

Sources4 archives

Databases and archives Stropenron hamata's data was compiled from.

GBIFGlobal Biodiversity Information Facility79 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI42 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics42 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF79 records

Environmental DNA1 datasets · 2 countries42 detections

DNA & barcodingBOLD42 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding42 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stropenron hamata has left across the world's sequence archives.

At a glance

DNA specimens42

BINs1

Marker genes1

eDNA detections42

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P640 bp consensus36 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 33 variable positions, in barcode order

58Tmostly conserved

59Cmostly conserved

82Cvariable

88Gvariable

235Tmostly conserved

241Avariable

259Cmostly conserved

274Tmostly conserved

337Gmostly conserved

346Amostly conserved

403Cmostly conserved

406Cvariable

469Cvariable

523Cvariable

613Tmostly conserved

614Gmostly conserved

615Amostly conserved

616Tmostly conserved

619Cmostly conserved

620Gmostly conserved

621Cmostly conserved

622Tmostly conserved

624Gmostly conserved

625Amostly conserved

627Gmostly conserved

628Amostly conserved

630Gmostly conserved

631Tmostly conserved

632Gmostly conserved

633Amostly conserved

636Cmostly conserved

638Amostly conserved

640Tmostly conserved

AACTCTATACTTTCTTTTCGGAGCCTGATCAGGAATATTAGGAACTTCCCTAAGACTTCTAATTCGAGCCGAATTAGGAAACCCTGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes7

BIN1

Most divergent pair4.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Stropenron propolasame genus9.7%Stropenron hieroglyphicasame genus9.8%Stropenron pudicasame genus10.0%Oxygonus obesussame family11.9%Stropenron nigricollissame genus12.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type79 records

Wild obs. + sensor76

Museum / vouchered3

Range

Area of Occupancy AOO312 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 34≤1 km 16≤10 km 3>10 km 5

58 georeferenced · 18 without coordinates

Open the mapobservation + sensor76

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	1
MAJClocation not on record	1
Lexington, US	1

3 institutions · 3 of 3 vouchered records shown

09Environmental DNA42 detections

Where the DNA of Stropenron hamata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found42

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 42 detections have coordinates

Open the map2 countries0

1. Forest & Woodland1. Forest & Woodland|1.4. Temperate ForestForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 11.2–17.7

Seasonal swing summer↔winter26.1 °C

Max temp (day)19.4 °C 15.0–22.7

Min temp (night)13.1 °C 7.90–14.9

Precipitation103 mm/mo 78.7–125

Air humidity59.7 % 56.0–63.4

Moisture balance-18.2 mm/mo -68.0–-4.20

Vapour deficit684 Pa 552–855

Wind speed3.00 m/s 2.40–5.20

Cloud cover45.3 % 41.0–53.6

CHELSA 1981–2010, ~9 km grid, at location & month of 40 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)