Strombosia scheffleri

Engl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Santalales/Strombosiaceae/Strombosia

At a glance

Occurrence records557

Data sources8

Biological traits28

DNA specimens7

eDNA detections3

Sources8 archives

Databases and archives Strombosia scheffleri's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility557 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Occurrence & distributionGBIF557 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

Strombosia scheffleri là một loài thực vật có hoa trong họ Olacaceae. Loài này được Engl. miêu tả khoa học đầu tiên năm 1909.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology7

Plant height27.5 m

⚠ sources differ — GIFT: 27.5 m · TRY: 17.4 m

Plant height max30.48 m

Seed length20.5 mm

Seed volume3 600 mm³

Seed volume max3 600 mm³

Seed volume min3 600 mm³

Seed width max17.9 mm

Life cycle & reproduction5

Deciduousnessevergreen

Dispersal typeanimal

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formtree

Woodinesswoody

Physiology & chemistry6

Leaf dry-matter content (LDMC)300 mg/g

Leaf n28.6 mg/g

Leaf p2.26 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density657 mg/cm³

Other traits2

Leaf thickness0.025 mm

Seed height max17.9 mm

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Strombosia scheffleri has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes5

GenBank sequences6

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLKC628116.1 ↗705 bpCameroon · 2008

ACGT

AGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGC …

Strombosia scheffleri voucher PM5151 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★rbcLa★ITS1trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type557 records

Wild obs. + sensor147

Museum / vouchered364

Cultivated / captive46

Range

Area of Occupancy AOO744 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 1

3 georeferenced · 144 without coordinates

Open the mapobservation + sensor147

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤1 km 3≤10 km 25

28 georeferenced · 336 without coordinates

Open the institutions mapphysical evidence364

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 46

46 georeferenced

Open the mapnot free-living46

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	61
Brussels, BE	36
Kew, GB	35
MeiseBGlocation not on record	31
BRLUlocation not on record	23
LBVlocation not on record	21
TAFORI-LSRClocation not on record	13
Leiden University Medical Centerlocation not on record	6
WAGlocation not on record	6
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	6
Herbier National du Gabonlocation not on record	6
Yaoundé, CM	5
Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record	4
MAlocation not on record	4
Bronx, US	3
Stockholm, SE	3
Limbe Botanical & Zoological Gardenslocation not on record	3
Plocation not on record	3
Arusha, TZ	2
Universite Libre de Bruxelleslocation not on record	2
Claremont, US	2
Glocation not on record	2
University of Santo Tomas Museumlocation not on record	2
Pretoria, ZA	1
Instituto de Investigação Científica Tropicallocation not on record	1
Botanic Gardenlocation not on record	1
CRSN_LWIROlocation not on record	1
Elocation not on record	1
Berlin, DE	1
University of Oxfordlocation not on record	1
LGlocation not on record	1
Montpellier, FR	1
University of Stellenboschlocation not on record	1
CJBGlocation not on record	1
MHUlocation not on record	1
EAlocation not on record	1
University of Burundilocation not on record	1
Centre D'Etude sur les Ressources Végétaleslocation not on record	1
Botanical Garden "Anastasie Fatu" of Iasilocation not on record	1
Universite Libre de Bruxelles, Herbariumlocation not on record	1

40 institutions · 296 of 364 vouchered records shown · 68 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Strombosia scheffleri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 24.2–24.2

Seasonal swing summer↔winter2.80 °C

Max temp (day)27.7 °C

Min temp (night)21.8 °C

Precipitation405 mm/mo

Air humidity74.7 %

Moisture balance296 mm/mo

Vapour deficit763 Pa

Wind speed0.9 m/s

Cloud cover33.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)