Strombosia ceylanica

Gardner · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Santalales/Strombosiaceae/Strombosia

At a glance

Occurrence records350

Data sources8

Biological traits20

DNA specimens19

eDNA detections9

Sources8 archives

Databases and archives Strombosia ceylanica's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility350 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Occurrence & distributionGBIF350 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD · NCBI19 specimens

01Narrative

Strombosia ceylanica is a tree in the family Olacaceae. The specific epithet ' is from the Latin meaning "of Ceylon".

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height30.5 m

⚠ sources differ — GIFT: 30.5 m · TRY: 28.9 m

Plant height max20 m

Life cycle & reproduction3

Deciduousnessevergreen

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry8

Leaf C:N ratio20.81 g/g

Leaf c538 mg/g

Leaf dry-matter content (LDMC)339 mg/g

Leaf n25.87 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)8.59 mm²/mg

Wood density744 mg/cm³

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Strombosia ceylanica has left across the world's sequence archives.

At a glance

DNA specimens19

Marker genes4

GenBank sequences4

eDNA detections9

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLLC736689.1 ↗432 bpMalaysia

ACGT

ACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACT …

Strombosia ceylanica 1920092 chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxgenase large subunit, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type350 records

Wild obs. + sensor173

Museum / vouchered177

Range

Area of Occupancy AOO536 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 162≤1 km 5≤10 km 3>10 km 1

171 georeferenced · 2 without coordinates

Open the mapobservation + sensor173

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy97% within 1 km

≤1 km 35≤10 km 1

36 georeferenced · 141 without coordinates

Open the institutions mapphysical evidence177

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	35
Cibinong Science Center, Herbarium Bogorienselocation not on record	15
Kew, GB	9
University of Stellenboschlocation not on record	2
South Kensington, GB	2
Xiamen, CN	1
ASUlocation not on record	1

7 institutions · 65 of 177 vouchered records shown · 112 without an institution code

09Environmental DNA9 detections

Where the DNA of Strombosia ceylanica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 26.1–26.2

Seasonal swing summer↔winter1.10 °C

Max temp (day)29.5 °C 29.4–29.5

Min temp (night)22.6 °C 22.6–23.0

Precipitation269 mm/mo 269–288

Air humidity68.1 % 68.1–68.5

Moisture balance133 mm/mo 133–152

Vapour deficit1,080 Pa 1,072–1,080

Wind speed1.20 m/s

Cloud cover57.6 % 55.3–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)