Strombocactus disciformis

(DC.) Britton & Rose · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Strombocactus

At a glance

Occurrence records35

Data sources11

Biological traits2

DNA specimens4

eDNA detections4

Sources11 archives

Databases and archives Strombocactus disciformis's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility35 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources2 traits

Occurrence & distributionGBIF35 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Strombocactus disciformis is a rare species of cacti and the only species of the genus Strombocactus. The plant originates from Central and Northeast Mexico.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Habitat & environment1

Climatedesert or dry shrubland

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Strombocactus disciformis has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences7

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKC777012.1 ↗490 bp

ACGT

GGATACCGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGTCAGAAGAAGCAGGAGCCGCAGTAGCTGCCGAATCTTC …

Strombocactus disciformis isolate Sd ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL2

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Strombocactus disciformis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 111×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Ross, R. 1981. Chromosome counts, cytology and reproduction in the Cactaceae. Amer. J. Bot. 68: 463–470.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type35 records

Wild obs. + sensor9

Museum / vouchered26

Range

Area of Occupancy AOO112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 9

9 georeferenced

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 19

19 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence26

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durango, MX	11
Mexico City, MX	7
Tlalnepantla, MX	2
Juriquilla, MX	2
Saint Louis, US	1
ASUlocation not on record	1

6 institutions · 24 of 26 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Strombocactus disciformis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 15.7–15.7

Seasonal swing summer↔winter9.60 °C

Max temp (day)22.0 °C

Min temp (night)9.00 °C

Precipitation34.7 mm/mo

Air humidity50.9 %

Moisture balance-93.3 mm/mo

Vapour deficit884 Pa

Wind speed4.10 m/s

Cloud cover25.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)