Stromanthe stromanthoides

(J.F.Macbr.) L.Andersson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Zingiberales/Marantaceae/Stromanthe

At a glance

Occurrence records319

Data sources7

Biological traits10

DNA specimens3

eDNA detections2

Sources7 archives

Databases and archives Stromanthe stromanthoides's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility319 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF319 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Stromanthe stromanthoides là một loài thực vật có hoa trong họ Marantaceae. Loài này được (J.F.Macbr.) L.Andersson miêu tả khoa học đầu tiên năm 1981.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 800 m

Elevation min30 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTFloresta de Terra Firme

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stromanthe stromanthoides has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

matKAY140334.1 ↗1 660 bp

ACGT

GTTCAGTACTTGTGAAACGTTTAATTATTCGAATGTATCAACAAATTTTTTTGATTTATTCGGTTAATGATTCTTACCAAAATCGATTCG …

Stromanthe stromanthoides tRNA-Lys (trnK) gene, partial sequence; and maturase (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL

plant barcode

08Occurrence & distribution

Record type319 records

Wild obs. + sensor145

Museum / vouchered174

Origin

Native1

Range

Area of Occupancy AOO692 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 76≤1 km 24≤10 km 9>10 km 3

112 georeferenced · 33 without coordinates

Open the mapobservation + sensor145

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 3≤1 km 1≤10 km 13>10 km 2

19 georeferenced · 155 without coordinates

Open the institutions mapphysical evidence174

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	45
Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record	23
Xiamen, CN	16
Göteborg, SE	15
Bronx, US	9
QCNElocation not on record	8
Davis, US	6
Riverside, US	6
Aarhus, DK	6
Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record	4
Chicago, US	4
arosemena tola, EC	4
Kew, GB	3
Vancouver, CA	3
JBRJlocation not on record	2
OTSlocation not on record	2
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	2
Université de Bordeauxlocation not on record	2
Museo Nacional de Costa Rica (MNCR)location not on record	2
University of Stellenboschlocation not on record	1
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	1
Quito, EC	1
Universidad de la Amazonia (UniAmazonia)location not on record	1
Fort Worth, US	1
UBClocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Universidad Tecnológica del Chocó (UTCH)location not on record	1
Berea Collegelocation not on record	1
Universidad del Quindío (UniQuindío)location not on record	1
Instituto Amazonico de Investigaciones Cientificas Sinchilocation not on record	1
Loja, EC	1

31 institutions · 174 of 174 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Stromanthe stromanthoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 16.9–16.9

Seasonal swing summer↔winter1.90 °C

Max temp (day)20.2 °C

Min temp (night)13.2 °C

Precipitation403 mm/mo

Air humidity70.9 %

Moisture balance313 mm/mo

Vapour deficit557 Pa

Wind speed1.40 m/s

Cloud cover77.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)