Strobilanthes cusia

(Nees) Kuntze · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Acanthaceae/Strobilanthes

At a glance

Occurrence records1 212

Data sources13

Biological traits10

DNA specimens9

eDNA detections9

Sources13 archives

Databases and archives Strobilanthes cusia's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 212 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources10 traits

Chemical compositionLOTUS · NPASS136 compounds

Occurrence & distributionGBIF1 212 records

Environmental DNA1 datasets · 0 countries9 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB · GoaT≈913 Mbp

01Narrative

Strobilanthes cusia, also known as Assam indigo or Chinese rain bell, is a is a perennial flowering plant of the family Acanthaceae. Native to South Asia, China, and Indochina, it was historically cultivated on a large scale in India and China as a source of indigo dye, which is also known as Assam indigo. In addition to being used for dye, it is also used in the traditional Chinese herbal medicine "Qingdai". Other names for this dicot include Pink strobilanthes and Strobilanthes flaccidifolius, where flaccidifolius is Latin for "drooping leaves".

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology1

Plant height1 m

Life cycle & reproduction3

Life formannual or subshrub

Life spanperennial

Raunkiær life formphanerophyte

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition136 compounds

Compounds documented for Strobilanthes cusia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Furostane steroids13

Isoflavones8

Spirostane steroids8

Flavones7

Flavonols6

Documented compounds136 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Dioscin	present	NPASS
(+)-Lyoniresinol 3alpha-O-beta-D-glucopyranoside	present	LOTUS
(1R,2S,4R,5'S,6S,7R,8S,9R,12S,13R)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosa-16,18-diene-6,2'-oxane]	present	NPASS
(1S,2S,4R,5'R,6R,7S,8R,9S,12S,13R,16S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-16-ol	present	NPASS
(1S,2S,4S,5'S,6R,7S,8R,9S,12R,13R,16S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-16-ol	present	NPASS
(2R,3R,4S,5S,6R)-2-[(2R)-4-[(1R,2S,4S,6S,7S,8R,9S,12S,13S,15R,16R,18S)-6,15-dihydroxy-7,9,13-trimethyl-16-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxymethyl]oxan-2-yl]oxy-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosan-6-yl]-2-methylbutoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
(2R,3R,4S,5S,6R)-2-[(2S)-4-[(1R,2S,4S,6S,7S,8R,9S,12S,13S,15R,16R,18S)-6,15-dihydroxy-7,9,13-trimethyl-16-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxymethyl]oxan-2-yl]oxy-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosan-6-yl]-2-methylbutoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
(2R,3R,4S,5S,6R)-2-[(2S,3S)-4-hydroxy-2,3-bis[(4-hydroxy-3,5-dimethoxyphenyl)methyl]butoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2R,3R,4S,5S,6R)-2-[[(2R,3S,4S)-2-(4-hydroxy-3,5-dimethoxyphenyl)-4-[(4-hydroxy-3,5-dimethoxyphenyl)methyl]oxolan-3-yl]methoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2R,3S,4R,5R,6S)-2-[(2S,3S,4R,5S,6S)-5-hydroxy-6-(hydroxymethyl)-2-[[(1S,2S,4S,6S,7S,8R,9R,12S,13S,16R)-6-hydroxy-7,9,13-trimethyl-6-[(3R)-3-methyl-4-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxybutyl]-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-en-16-yl]oxy]-4-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Strobilanthes cusia has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes4

GenBank sequences10

eDNA detections9

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLPX262336.1 ↗144 111 bpChina · 2022

ACGT

TGTAACAAGCTACACCAAGTAAGAAGTGTAGAACTATTAGTTCATAAGGACCACCGTTGTATAACCACTCATCAACGGATGCTGCTTCCC …

Strobilanthes cusia isolate Sc69 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL10★ITS★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Strobilanthes cusia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈913 000 000 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Strobilanthes cusia0.91 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidydiploid inferred

Chromosome records16–322n range32median32mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 322×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Ge, C. j., Y. k. Li, P. Wan & P. s. Hsu. 1989. Chromosome numbers of 31 medicinal plants from Shandong Province. Pp. 267--272 in D. Hong (editor), Plant Chromosome Research 1987.

CCDB · ipcn-api-dl — Iwatsubo, Y., M. Mishima & N. Naruhashi. 1993. Chromosome numbers in four Japanese species of Strobilanthes (Acanthaceae). CIS Chromosome Inform. Serv. 54: 3–5.

2n 161×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Hsu, C.-C. 1968

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelscaffold

08Occurrence & distribution

Record type1 212 records

Wild obs. + sensor865

Museum / vouchered346

Other1

Origin

Native6

Range

Area of Occupancy AOO1 740 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 463≤1 km 94≤10 km 31>10 km 16

604 georeferenced · 261 without coordinates

Open the mapobservation + sensor865

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 345 without coordinates

Open the institutions mapphysical evidence346

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions25 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Guangzhou, CN	77
Beijing, CN	66
Guilin, CN	55
Taipei, TW	16
Guiyang, CN	15
Taipei, TW	15
Chengdu, CN	9
Xiamen, CN	7
TAIElocation not on record	6
Guangzhou, CN	6
Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record	6
Kunming, CN	5
Nishihara, JP	5
Odawara, JP	4
Nishihara, JP	3
Moscow State Universitylocation not on record	3
Taipei, TW	3
Kew, GB	3
National Institute of Biological Resourceslocation not on record	3
South China Normal Universitylocation not on record	3
Wuhan, CN	3
Tsukuba, JP	3
Chiba, JP	2
Paris, FR	2
Saint Louis, US	1
Minia, EG	1
“Manash Kozybayev North Kazakhstan University" NPLClocation not on record	1
Jena Microbial Resource Collectionlocation not on record	1
Guiyang, CN	1
Kochi, JP	1
Strecker Museum, Baylor Universitylocation not on record	1
Shanghai, CN	1
黔东南州民族医药研究所标本室location not on record	1
Xian, CN	1
DOI/NPS, Colonial National Historical Parklocation not on record	1

35 institutions · 331 of 346 vouchered records shown · 15 without an institution code

09Environmental DNA9 detections

Where the DNA of Strobilanthes cusia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Strobilanthes cusia

At a glance

Sources13 archives

Size & morphology1

Life cycle & reproduction3

Habitat & environment5

Physiology & chemistry1

Compound class profile5 classes

Documented compounds136 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type1 212 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions25 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 212 records