Streptoglossa odora

(F.Muell.) Dunlop · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Streptoglossa

At a glance

Occurrence records930

Data sources8

Biological traits29

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Streptoglossa odora's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility930 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources29 traits

Chemical compositionLOTUS · NPASS28 compounds

Occurrence & distributionGBIF930 records

DNA & barcodingNCBIsequences

01Narrative

Streptoglossa odora is a species of flowering plant in the family Asteraceae. It is a spreading, perennial herb with pink or bluish-purple flowers. It grows in Queensland, Western Australia and the Northern Territory.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology10

Fruit length2.5 mm

Leaf length35 mm

Leaf mass per area194 g/m2

Leaf width6 mm

Plant height0.6 m

Plant height max0.7 m

Plant height min0.25 m

Seed mass1.1 mg

⚠ sources differ — TRY: 1.1 mg · AusTraits: 0.871 mg · GIFT: 1.18 mg

Seed mass max1.29 mg

Seed mass min1.06 mg

Life cycle & reproduction7

Dispersal typewind

Flowering timennnyyyyyyyyn

Life spanperennial

Pollination syndromeinsect

Raunkiær life formtherophyte

Resprouting capacitypartial_resprouting

Sex typegynomonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formherb

Leaf compoundnesssimple

Leaf shapelinear oblanceolate

Woodinessnon-woody

⚠ sources differ — TRY: non-woody · AusTraits: herbaceous woody_base · GIFT: non-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition28 compounds

Compounds documented for Streptoglossa odora across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Anthraquinones and anthrones8

Eudesmane sesquiterpenoids6

Flavonols2

Simple phenolic acids1

Cadinane sesquiterpenoids1

Documented compounds28 total

Tissue Source Quantified only

Compound	Amount	Source
(3-Methyl-2-oxo-6-propan-2-ylcyclohex-3-en-1-yl) 2-methylbut-2-enoate	present	LOTUS
(3R,8R,9R,10S,13R,14R,17R)-17-[(Z,2S,5S)-5-ethyl-6-methylhept-3-en-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
(3S,8R,9R,10R,13R,14R,17R)-10,13-dimethyl-17-[(2R)-6-methylheptan-2-yl]-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
(3S,8R,9R,10R,13R,14R,17R)-17-[(2R,5R)-5,6-dimethylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
(3S,8R,9R,10R,13R,14R,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
1,8-Dihydroxy-3-(hydroxymethyl)-6-methylanthracene-9,10-dione	present	NPASS
[(1R,2R,4aS,8aR)-1-hydroxy-1,4a-dimethyl-6-oxo-7-propan-2-ylidene-2,3,4,5,8,8a-hexahydronaphthalen-2-yl] (2R,3S)-2,3-dimethyloxirane-2-carboxylate	present	LOTUS
[(1S,2R,4aR,8aR)-1-acetyloxy-7-(2-hydroxypropan-2-yl)-1,4a-dimethyl-6-oxo-3,4,5,8a-tetrahydro-2H-naphthalen-2-yl] (Z)-2-methylbut-2-enoate	present	LOTUS
[(1S,2R,4aR,8aR)-1-hydroxy-7-(2-hydroxypropan-2-yl)-1,4a-dimethyl-6-oxo-3,4,5,8a-tetrahydro-2H-naphthalen-2-yl] (2R,3S)-3-chloro-2-hydroxy-2-methylbutanoate	present	LOTUS
[(1S,2R,4aR,8aR)-1-hydroxy-7-(2-hydroxypropan-2-yl)-1,4a-dimethyl-6-oxo-3,4,5,8a-tetrahydro-2H-naphthalen-2-yl] (2S,3R)-2,3-dimethyloxirane-2-carboxylate	present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Streptoglossa odora has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSLN607591.1 ↗821 bp

ACGT

TTGAACCTTATCGTTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAGCCTGCGGAAGGATCATTGTCGAAACCTGCATAGCA …

Streptoglossa odora genomic DNA sequence contains ITS1, 5.8S rRNA gene, ITS2, specimen voucher Short 4269 (S)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type930 records

Wild obs. + sensor300

Museum / vouchered566

Cultivated / captive3

Other61

Origin

Native66

Range

Area of Occupancy AOO2 908 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 157≤1 km 1≤10 km 10

168 georeferenced · 132 without coordinates

Open the mapobservation + sensor300

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 188≤1 km 71≤10 km 198>10 km 32

489 georeferenced · 77 without coordinates

Open the institutions mapphysical evidence566

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Palmerston, AU	173
Brisbane, AU	128
Kensington, AU	86
Canberra, AU	53
Museo Entomologico de Leonlocation not on record	50
Mount Annan, AU	24
Adelaide, AU	22
John T. Waterhouse Herbariumlocation not on record	7
University of Stellenboschlocation not on record	7
Smithfield, AU	6
James Cook Townsvillelocation not on record	3
Stockholm, SE	2
BGPAlocation not on record	2
Honolulu, US	1
Armidale, AU	1

15 institutions · 565 of 566 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)