Streptoglossa decurrens

(DC.) Dunlop · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Streptoglossa

At a glance

Occurrence records361

Data sources7

Biological traits26

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Streptoglossa decurrens's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility361 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources26 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF361 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaTgenome

01Narrative

Streptoglossa decurrens is a species of flowering plant in the family Asteraceae. It grows in Queensland, Western Australia and the Northern Territory. It is an upright, aromatic perennial herb or shrub with pink-purplish or reddish purple flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology9

Fruit length2.25 mm

Leaf length40 mm

Leaf width15.5 mm

Plant height0.5 m

Plant height max1.5 m

Plant height min0.2 m

Seed mass1.31 mg

Seed mass max1.31 mg

Seed mass min1.31 mg

Life cycle & reproduction8

Dispersal typewind

Flowering timennnnnnyyyyyn

Life spanperennial

⚠ sources differ — TRY: perennial · AusTraits: perennial · GIFT: annual

Pollination syndromeinsect

Raunkiær life formtherophyte

Reproductive maturity1 years

Resprouting capacityfire_killed

Sex typegynomonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climberself-supporting

Fruit fleshinessdry

Fruit typeachene

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: herb shrub · TRY: herb/shrub

Leaf compoundnesssimple

Leaf shapeelliptical oblanceolate oblong

Woodinessvariable

⚠ sources differ — TRY: non-woody/woody · AusTraits: herbaceous woody · GIFT: non-woody

03Chemical composition1 compounds

Compounds documented for Streptoglossa decurrens across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Himachalane sesquiterpenoids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
(4aR,5S,9S,9aS)-9-(hydroxymethyl)-2,5,9-trimethyl-4,4a,6,7,8,9a-hexahydro-3H-benzo[7]annulen-5-ol		present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Streptoglossa decurrens has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSLN607589.1 ↗805 bp

ACGT

TGGAACCTTATCGTTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCATAGCA …

Streptoglossa decurrens genomic DNA sequence contains ITS1, 5.8S rRNA gene, ITS2, specimen voucher Nordenstam & Anderberg 301 (S)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceGoaT

The complete instruction manual Streptoglossa decurrens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidydiploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type361 records

Wild obs. + sensor64

Museum / vouchered286

Other11

Origin

Native19

Range

Area of Occupancy AOO1 172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 19≤1 km 2>10 km 2

23 georeferenced · 41 without coordinates

Open the mapobservation + sensor64

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 71≤1 km 26≤10 km 131>10 km 19

247 georeferenced · 39 without coordinates

Open the institutions mapphysical evidence286

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	112
Palmerston, AU	66
Museo Entomologico de Leonlocation not on record	31
Brisbane, AU	25
Canberra, AU	25
Adelaide, AU	15
Mount Annan, AU	5
BGPAlocation not on record	3
Smithfield, AU	2
Hobart, AU	1

10 institutions · 285 of 286 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)