Streptanthus hyacinthoides

Hook. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Brassicaceae/Streptanthus

At a glance

Occurrence records261

Data sources9

Biological traits10

DNA specimens10

eDNA detections10

Sources9 archives

Databases and archives Streptanthus hyacinthoides's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility261 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF261 records

Environmental DNA1 datasets · 0 countries10 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Streptanthus hyacinthoides is a species of flowering plant in the mustard family known by the common name smooth jewelflower. It is found in Texas, Arkansas, Oklahoma, Louisiana and Nebraska, occurring in prairies, grasslands, and roadsides. The specific name hyacinthoides is Greek, referring to the resemblance of the species to the genus Hyacinthus, and the common name "smooth jewelflower" refers to the glabrous stems of the plant.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Streptanthus hyacinthoides has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes2

GenBank sequences10

eDNA detections10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU620276.1 ↗223 bpUSA

ACGT

ACTNTCGGTGGGCCGGTTTCTTTGCTGATCCCGCGCCTGCCGATTCCGTGGTTATGCGCATGGTCCCGGTCAAGATTTTAATCTTGGCTG …

Streptanthus hyacinthoides voucher Thomas & Thomas 100,319 (MO) internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Streptanthus hyacinthoides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidypolyploid inferred

Chromosome records28–282n range28median28mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 282×CCDB · ipcn-api-dl · CCDB · brass

CCDB · ipcn-api-dl — Zhao, Z. 1996. Documented chromosome numbers 1996:2. Miscellaneous U. S. A. and Mexican species, mostly Asteraceae. Sida 17(1): 259–263.

CCDB · brass — Zhao

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.513 ↗

08Occurrence & distribution

Record type261 records

Wild obs. + sensor143

Museum / vouchered118

Range

Area of Occupancy AOO632 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 61≤1 km 14≤10 km 3>10 km 32

110 georeferenced · 33 without coordinates

Open the mapobservation + sensor143

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 3≤1 km 17≤10 km 39>10 km 7

66 georeferenced · 52 without coordinates

Open the institutions mapphysical evidence118

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Fort Worth, US	25
Wuzhou, CN	24
Bronx, US	20
BAYLUlocation not on record	9
Austin, US	7
EL PASO, US	3
Provo, US	3
Bloomington, US	3
Jena Microbial Resource Collectionlocation not on record	2
Chadron, US	2
Tampa, US	2
Saint Louis, US	2
US	2
Bangkok, TH	2
Durango, MX	2
ASUlocation not on record	2
Mississippi State, US	1
Riverside, US	1
Moscow State Universitylocation not on record	1
Jackson, US	1
University of Stellenboschlocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Chongqing Museumlocation not on record	1

23 institutions · 117 of 118 vouchered records shown · 1 without an institution code

09Environmental DNA10 detections

Where the DNA of Streptanthus hyacinthoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)