Streptanthus carinatus

C.Wright · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Brassicaceae/Streptanthus

At a glance

Occurrence records772

Data sources10

Biological traits10

DNA specimens6

eDNA detections5

Sources10 archives

Databases and archives Streptanthus carinatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility772 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF772 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Streptanthus carinatus est une espèce de plantes à fleurs de la famille des Brassicaceae, originaire du sud des États-Unis et du nord du Mexique.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formannual or biennial

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Streptanthus carinatus has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences8

eDNA detections5

The DNA barcodea real sequence read deposited for this species

ITSKX646465.1 ↗664 bp

ACGT

TCGATACCTGTAAACAGAACGACCCGAGAACGATGAATCATCACTCTCGGTGGGCCGGTTTCTTAGCTGATCCCGCGCCTGCCGATTCCG …

Streptanthus carinatus subsp. arizonicus isolate STRCA-1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS6★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Streptanthus carinatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidypolyploid inferred

Chromosome records28–282n range28median28mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 285×CCDB · ipcn-api-dl · CCDB · eflora · CCDB · brass

CCDB · ipcn-api-dl — Rollins, R. C. & L. RUDENBERG. 1977. Chromosome numbers of Cruciferae III. Contr. Gray Herb. 207: 101–116.

CCDB · eflora

CCDB · brass — Rollins & Rdenberg

n 149×CCDB · ipcn-api-dl · CCDB · brass

CCDB · ipcn-api-dl — WEEDIN, J. F. & A. M. POWELL. 1980. In Chromosome number reports LXIX. Taxon 29: 716–718.

CCDB · ipcn-api-dl — Kruckeberg, A. R., J. E. Rodman & R. D. Worthington. 1982. Natural hybridization between Streptanthus arizonicus and S. carinatus (Cruciferae). Syst. Bot. 7: 291–299.

CCDB · ipcn-api-dl — Rollins, R. C. & L. RUDENBERG. 1977. Chromosome numbers of Cruciferae III. Contr. Gray Herb. 207: 101–116.

CCDB · brass — Rollins

CCDB · brass — Weedin & Powell

CCDB · brass — Kruckeberg et al.

CCDB · brass — Rollins & Rdenberg

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.513 ↗

08Occurrence & distribution

Record type772 records

Wild obs. + sensor650

Museum / vouchered122

Range

Area of Occupancy AOO1 520 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 396≤1 km 64≤10 km 27>10 km 20

507 georeferenced · 143 without coordinates

Open the mapobservation + sensor650

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 10≤1 km 18≤10 km 11>10 km 4

43 georeferenced · 79 without coordinates

Open the institutions mapphysical evidence122

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
EL PASO, US	84
Austin, US	14
ASUlocation not on record	11
Mexico City, MX	4
New Mexico Museum of Natural History and Sciencelocation not on record	3
Riverside, US	2
University of Alabamalocation not on record	2
Austin, US	1
Hermosillo, MX	1

9 institutions · 122 of 122 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Streptanthus carinatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)