Streptanthus bernardinus

(Greene) Parish · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Brassicaceae/Streptanthus

At a glance

Occurrence records221

Data sources10

Biological traits5

DNA specimens5

eDNA detections3

Sources10 archives

Databases and archives Streptanthus bernardinus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility221 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources5 traits

Occurrence & distributionGBIF221 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Streptanthus bernardinus is a species of flowering plant in the mustard family known by the common name Laguna Mountains jewelflower, or Laguna Mountain jewelflower.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial or subshrub

Life spanperennial

Habitat & environment3

Climatedesert or dry shrubland

Climberself-supporting

Growth formSubshrub, Forb/herb

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Streptanthus bernardinus has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKY640287.1 ↗665 bp

ACGT

AGGATCATTGTCGATACCTGTAAACAGAACGACCCGAGAACGATGAATCATCACTCTCGGTGGGCCGGTTTCTTAGCTGATCCCCGCCTG …

Streptanthus bernardinus voucher JM Porter 15313 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Streptanthus bernardinus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records14–282n range21median28mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 141×CCDB · brass

CCDB · brass — Rollins

2n 281×CCDB · eflora

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type221 records

Wild obs. + sensor34

Museum / vouchered187

Origin

Native70

Range

Area of Occupancy AOO444 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 34

34 georeferenced

Open the mapobservation + sensor34

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤1 km 65≤10 km 53>10 km 2

120 georeferenced · 67 without coordinates

Open the institutions mapphysical evidence187

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Claremont, US	73
Riverside, US	34
CASlocation not on record	23
San Diego, US	16
Santa Barbara, US	7
Northridge, US	3
Arcata, US	2
Angwin, US	2
EL PASO, US	1
Phoenix, US	1
San Bernardino, US	1
Davis, US	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Saint Louis, US	1
San Luis Obispo, US	1
Los Angeles, US	1

16 institutions · 168 of 187 vouchered records shown · 19 without an institution code

09Environmental DNA3 detections

Where the DNA of Streptanthus bernardinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.8 °C 23.8–23.8

Seasonal swing summer↔winter13.7 °C

Max temp (day)31.4 °C

Min temp (night)17.2 °C

Precipitation5.40 mm/mo

Air humidity52.2 %

Moisture balance-158 mm/mo

Vapour deficit1,404 Pa

Wind speed1.50 m/s

Cloud cover13.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)