Streblus asper

Lour. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Moraceae/Streblus

At a glance

Occurrence records763

Data sources13

Biological traits29

DNA specimens12

eDNA detections11

Sources13 archives

Databases and archives Streblus asper's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility763 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources29 traits

Chemical compositionDukesPhytochem · NPASS23 compounds

Occurrence & distributionGBIF763 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD · NCBI12 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Streblus asper is a tree known by several common names, including Siamese rough bush, khoi, serut, and toothbrush tree. It is a medium-sized tree native to dry regions in Indonesia, Cambodia, Thailand, India, Sri Lanka, Malaysia, and Vietnam. In the Philippines, it is commonly known as "bogta-e","bogtalay", and "Kalyos". In Cambodia, it is known as Snay. Several rural communes in Cambodia were named after the tree such as Snay Pol village (Poisonous Snay) of Prey Veng and Krang Snay (Hill of Snay) of Kampot Province. In Malaysia, it is known as "kesinai".

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology9

Leaf length42.5 mm

Leaf length max60 mm

Leaf length min25 mm

Leaf width27.5 mm

Leaf width max35 mm

Leaf width min20 mm

Plant height13.5 m

Plant height max10 m

Seed mass38.11 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max950 m

Elevation mean575 m

Elevation min200 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry5

Leaf dry-matter content (LDMC)436 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)14.73 mm²/mg

Wood density523 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition23 compounds

Compounds documented for Streblus asper across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking💊 Medicinal use documented🌿 Tea

Compound class profile4 classes

Neolignans6

Cinnamic acids and derivatives $ Neolignans2

Arylnaphthalene and aryltetralin lignans1

Furofuranoid lignans1

Documented compounds23 total

Tissue Source Quantified only

Compound	Class	Amount	Source
BETULIN		1,000 ppm	DukesPhytochem

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Streblus asper has left across the world's sequence archives.

At a glance

DNA specimens12

Marker genes4

GenBank sequences10

eDNA detections11

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKT002557.1 ↗707 bpChina

ACGT

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCGCAGCAGAAAGACCCGCGAACACGTTACAACACTCGGGGGGTAAG …

Streblus asper voucher XNSK0005 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL7★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Streblus asper carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–262n range25median24mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 241×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Mitra, K. & Datta, N. 1967

2n 261×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Gajapathy, C. 1961 ; Hans, A.S. 1972 ; Mehra, P.N. & Hans, A.S. 1972 ; Sarkar, A.K. et al. 1973a ; Mehra, P.N. & Gill, B.S. 1974

n 133×CCDB · book-ipcn72 · CCDB · book-ipcn75-78

CCDB · book-ipcn72 — HANS, A.S. 1972. Cytomorphology of arborescent Moraceae. J. Arnold Arbor. 53: 216-225.

CCDB · book-ipcn75-78 — Mehr a & Gill 1974

CCDB · book-ipcn75-78 — Mehr a 1976

n 121×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — MITRA, K., & N. DATTA. 1967. In IOPB chromosome number reports XIII. Taxon 16: 445-461.

n 141×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Singh, M. R. 1982. Effects of IAA with maleic hydrazide and colchicine on root tip mitosis. Cytologia 47: 419–426.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type763 records

Wild obs. + sensor200

Museum / vouchered563

Origin

Native1

Range

Area of Occupancy AOO1 440 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 100≤1 km 24≤10 km 5>10 km 7

136 georeferenced · 64 without coordinates

Open the mapobservation + sensor200

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤1 km 37≤10 km 2>10 km 4

43 georeferenced · 520 without coordinates

Open the institutions mapphysical evidence563

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions30 of 41 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kunming, CN	118
Beijing, CN	56
Guangzhou, CN	47
Guilin, CN	26
Baroda, IN	22
Bronx, US	16
Pondicherry, IN	14
Siouxland Heritage Museumlocation not on record	13
Kew, GB	8
Guangzhou, CN	6
Nanjing, CN	5
Berlin, DE	5
SCAUlocation not on record	5
Saint Louis, US	5
Shanghai, CN	4
Chengdu, CN	4
Paris, FR	4
Miami, US	3
Fort Worth, US	3
Sri Ramaswamy Memorial Universitylocation not on record	3
University of Stellenboschlocation not on record	2
Gujarat Biodiversity Gene Banklocation not on record	2
Dehra Dun, IN	2
National Institute of Biological Resourceslocation not on record	2
Cincinnati, US	2
MSB-3349location not on record	1
Changsha, CN	1
South Kensington, GB	1
Bloomington, US	1
Edinburgh, GB	1
Burlington, US	1
Honolulu, US	1
Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record	1
Cibinong Science Center, Herbarium Bogorienselocation not on record	1
Wuhan, CN	1
Servico de Microbiologia e Imunologialocation not on record	1
Stockholm, SE	1
Vietnam National Museum of Naturelocation not on record	1
Philadelphia, US	1
Columbia, US	1
Xiamen, CN	1

41 institutions · 393 of 563 vouchered records shown · 170 without an institution code

09Environmental DNA11 detections

Where the DNA of Streblus asper was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–30.6

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C 30.5–34.2

Min temp (night)19.3 °C 19.3–26.8

Precipitation109 mm/mo 109–271

Air humidity52.0 % 52.0–62.0

Moisture balance-17.8 mm/mo -63.9–123

Vapour deficit1,616 Pa 1,477–1,847

Wind speed1.80 m/s 1.80–4.60

Cloud cover25.2 % 15.7–29.5

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)