Stomias longibarbatus

(Brauer, 1902) · species

image placeholder — illustration coming later

Animalia/Chordata/Stomiiformes/Stomiidae/Stomias

At a glance

Occurrence records333

Data sources8

Biological traits6

DNA specimens6

eDNA detections6

Sources8 archives

Databases and archives Stomias longibarbatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility118 records↗

OBISOcean Biodiversity Information System215 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS333 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD6 specimens

01Narrative

Stomias longibarbatus is een straalvinnige vissensoort uit de familie van Stomiidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1902 door Brauer.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length43 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebathypelagic

Other traits3

Depth max1 463 m

Depth min400 m

Vulnerability40.98

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stomias longibarbatus has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Where individuals differ — all 102 variable positions, in barcode order

7Cmostly conserved

10Amostly conserved

16Cmostly conserved

31Amostly conserved

43Gmostly conserved

46Cmostly conserved

58Cmostly conserved

61Cmostly conserved

67Gmostly conserved

73Avariable

76Cmostly conserved

112Cmostly conserved

118Gmostly conserved

127Cmostly conserved

133Tmostly conserved

136Tmostly conserved

145Gmostly conserved

148Tmostly conserved

154Tmostly conserved

167Amostly conserved

175Tmostly conserved

178Cmostly conserved

187Cmostly conserved

193Gmostly conserved

196Gmostly conserved

202Tvariable

205Gmostly conserved

211Cmostly conserved

220Tmostly conserved

232Tmostly conserved

235Tmostly conserved

244Cmostly conserved

256Cmostly conserved

259Gmostly conserved

268Tmostly conserved

271Cmostly conserved

274Cmostly conserved

277Cvariable

280Gmostly conserved

286Cmostly conserved

289Gmostly conserved

295Cmostly conserved

298Amostly conserved

304Tmostly conserved

307Gmostly conserved

331Tmostly conserved

334Tmostly conserved

340Tmostly conserved

343Cmostly conserved

346Tmostly conserved

352Amostly conserved

358Gmostly conserved

361Cvariable

367Cmostly conserved

373Tmostly conserved

385Amostly conserved

391Cmostly conserved

394Cmostly conserved

406Gmostly conserved

412Gmostly conserved

413Amostly conserved

415Tmostly conserved

424Cmostly conserved

427Cmostly conserved

436Tmostly conserved

445Tmostly conserved

448Amostly conserved

454Cvariable

460Tmostly conserved

472Avariable

475Tvariable

484Gmostly conserved

487Cmostly conserved

496Gmostly conserved

499Gmostly conserved

502Cmostly conserved

509Gmostly conserved

517Tmostly conserved

518Gmostly conserved

520Amostly conserved

526Gmostly conserved

529Tmostly conserved

532Cmostly conserved

538Tmostly conserved

541Tvariable

547Cmostly conserved

550Amostly conserved

553Gmostly conserved

559Cmostly conserved

562Tmostly conserved

565Gmostly conserved

571Cmostly conserved

577Cmostly conserved

580Cmostly conserved

593Cmostly conserved

598Cmostly conserved

604Tmostly conserved

610Cmostly conserved

616Amostly conserved

628Gmostly conserved

646Avariable

650Cmostly conserved

CCTCTACCTAGTATTCGGTGCTTGAGCTGGAATGGTCGGCACGGCCTTAAGCCTGCTCATCCGGGCGGAGCTAAGCCAACCCGGCGCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.6%

Haplotypes3

BINs2

Most divergent pair15.0%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Stomias atriventersame genus13.3%Stomias boasame genus13.7%Leptostomias bermudensissame family14.1%Diplophos rebainsisame order14.1%Stomias gracilissame genus14.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type333 records

Wild obs. + sensor61

Museum / vouchered262

Other10

Origin

Native1

Range

Area of Occupancy AOO856 km²

Depth

0–200 m sunlit12

200–1000 m twilight90

1–4 km midnight24

>4 km abyssal0

median 664.2 m · max 2 280 m · 126 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤1 km 8>10 km 4

12 georeferenced · 49 without coordinates

Open the mapobservation + sensor61

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤1 km 10≤10 km 8>10 km 33

51 georeferenced · 211 without coordinates

Open the institutions mapphysical evidence262

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
FishBaselocation not on record	32
Copenhagen, DK	13
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	9
Sydney, AU	7
South African Institute for Aquatic Biodiversitylocation not on record	4
Cambridge, US	3
University of California San Diegolocation not on record	3
The Atlantic reference Centrelocation not on record	3
Washington, US	3
University of Texas Biodiversity Collections (UTBC)location not on record	2
New Haven, US	2
Bergen, NO	2
UWFClocation not on record	1
Wuzhou, CN	1
CASlocation not on record	1
Museums Victorialocation not on record	1
Sherkin Island Marine Stationlocation not on record	1
South Kensington, GB	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1
IEOlocation not on record	1
North Carolina Museum of Natural Scienceslocation not on record	1
Chicago, US	1

22 institutions · 93 of 262 vouchered records shown · 5 without an institution code

09Environmental DNA6 detections

Where the DNA of Stomias longibarbatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 24.1–27.0

Seasonal swing summer↔winter9.20 °C

Max temp (day)25.1 °C 24.8–27.7

Min temp (night)23.9 °C 23.2–26.2

Precipitation72.1 mm/mo 24.6–173

Air humidity62.8 % 61.9–63.6

Vapour deficit1,126 Pa 1,091–1,356

Cloud cover31.6 % 21.5–36.1

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)