Stoebe rosea

Dod · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Stoebe

At a glance

Occurrence records180

Data sources6

Biological traits15

DNA specimens1

eDNA detections17

Sources6 archives

Databases and archives Stoebe rosea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility180 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF180 records

Environmental DNA2 datasets · 1 countries17 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Stoebe rosea là một loài thực vật có hoa trong họ Cúc. Loài này được Wolley-Dod miêu tả khoa học đầu tiên năm 1901.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height max0.5 m

Plant height min0.3 m

Seed mass0.475 mg

Life cycle & reproduction2

Life formsubshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max500 m

Elevation min0 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stoebe rosea has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections17

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKP322481.1 ↗629 bp

ACGT

GATCATTGTCGAATCCTGCACAGCAGAACGACCCGTGAACATGTAATACAACTAGGCATCATAGAGATCAAACTTTAGTTTGAGAACTTT …

Stoebe rosea internal transcribed spacer 1, partial sequence; 5.8S ribsomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type180 records

Wild obs. + sensor146

Museum / vouchered34

Range

Area of Occupancy AOO100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 122≤1 km 7≤10 km 4>10 km 1

134 georeferenced · 12 without coordinates

Open the mapobservation + sensor146

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 6

6 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	13
Cape Town, ZA	12
Kew, GB	6
Vancouver, CA	1
MSB-3054location not on record	1

5 institutions · 33 of 34 vouchered records shown · 1 without an institution code

09Environmental DNA17 detections

Where the DNA of Stoebe rosea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys2

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 18.2–18.2

Seasonal swing summer↔winter10.3 °C

Max temp (day)24.9 °C

Min temp (night)13.0 °C

Precipitation60.1 mm/mo

Air humidity59.6 %

Moisture balance-66.0 mm/mo

Vapour deficit842 Pa

Wind speed3.70 m/s

Cloud cover12.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)