Stixis suaveolens

(Roxb.) Pierre · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Stixaceae/Stixis

At a glance

Occurrence records141

Data sources8

Biological traits11

DNA specimens12

eDNA detections12

Sources8 archives

Databases and archives Stixis suaveolens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility141 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF141 records

Environmental DNA1 datasets · 1 countries12 detections

DNA & barcodingBOLD · NCBI12 specimens

01Narrative

Stixis suaveolens is a species of liana in the family Resedaceae; no subspecies are listed in the Catalogue of Life. It is found in India, southern China and Indo-China; in Vietnam it may be called cây tôn nấm.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Deciduousnessevergreen

Life formclimbing shrub or liana

Life spanperennial

Habitat & environment7

Climatewet tropical

Climberobligatory

Elevation max700 m

Elevation min300 m

Epiphyteterrestrial

Growth formother

⚠ sources differ — GIFT: other · TRY: Climber

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stixis suaveolens has left across the world's sequence archives.

At a glance

DNA specimens12

Marker genes3

GenBank sequences10

eDNA detections12

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPQ097677.1 ↗701 bpViet Nam · 2024

ACGT

GGAAGGATCATTGTCGAAACCTGTCGGAAGCGGAGCGACCCGAGGACGAGTATTGCGATGCGGGAAAGGGCGGGCCTCCCACGGGACCGT …

Stixis suaveolens voucher CMR-MR-05 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★ITS6

plant barcodefungal barcode

08Occurrence & distribution

Record type141 records

Wild obs. + sensor2

Museum / vouchered139

Range

Area of Occupancy AOO128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 1 without coordinates

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 138 without coordinates

Open the institutions mapphysical evidence139

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kunming, CN	59
Guangzhou, CN	24
Beijing, CN	15
Guilin, CN	8
Nanjing, CN	8
Guangzhou, CN	7
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	6
Paris, FR	2
Stockholm, SE	2
Xiamen, CN	1
Beijing Natural History Museumlocation not on record	1
Southwest Forestry Collegelocation not on record	1
South Kensington, GB	1

13 institutions · 135 of 139 vouchered records shown · 3 without an institution code

09Environmental DNA12 detections

Where the DNA of Stixis suaveolens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–10.0

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.7 °C

Min temp (night)3.10 °C

Precipitation13.8 mm/mo

Air humidity45.7 %

Moisture balance-95.2 mm/mo

Vapour deficit827 Pa

Wind speed4.50 m/s

Cloud cover24.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)