Stirtoniella kelica — The Life Data

Fungi/Ascomycota/Lecanoromycetes/Lecanorales/Ramalinaceae/Stirtoniella

At a glance

Occurrence records95

Data sources5

Biological traits0

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Stirtoniella kelica's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility95 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF95 records

DNA & barcodingNCBIsequences

01Narrative

Stirtoniella is a lichen genus in the family Ramalinaceae. It is a monotypic genus, containing the single species Stirtoniella kelica, a crustose and corticolous lichen originally described from New Zealand in 1873 as a species of Lecidea. The photobiont is an alga of the family Chlorococcaceae. The genus is named after Scottish mycologist James Stirton.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stirtoniella kelica has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG926021.1 ↗547 bpNew Zealand · 1992

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGAGAGGGGCCCCGCGCTCCAGGGGGCTCTGCCCCCGCCTTTCACCCTGTGATTACG …

Stirtoniella kelica isolate 5757 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type95 records

Wild obs. + sensor33

Museum / vouchered62

Range

Area of Occupancy AOO328 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 16≤1 km 10≤10 km 1

27 georeferenced · 6 without coordinates

Open the mapobservation + sensor33

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 1≤1 km 14≤10 km 3

18 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence62

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	31
Hobart, AU	14
Wellington, NZ	6
Christchurch, NZ	4
M-Lichenslocation not on record	3
Canberra, AU	3
Museo Entomologico de Leonlocation not on record	1

7 institutions · 62 of 62 vouchered records shown