Stipagrostis uniplumis

(Licht.) De Winter · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Stipagrostis

At a glance

Occurrence records497

Data sources9

Biological traits21

DNA specimens11

eDNA detections7

Sources9 archives

Databases and archives Stipagrostis uniplumis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility497 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Occurrence & distributionGBIF497 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI11 specimens

Genome at a glanceCCDB2n = 44

01Narrative

Stipagrostis uniplumis est une espèce de graminée vivace appartenant à la famille des Poacées. C'est la plus commune des espèces de Stipagrostis et on le trouve dans la plupart des régions arides d'Afrique, aussi loin au nord que le Sénégal et en Somalie. Ce n'est pas une bonne graminée pour le pâturage en raison de ses feuilles coriaces et raides, mais elle est relativement bien pâturée dans les régions sèches et les zones dispersées, où elle peut dominer. L'herbe peut atteindre 90 cm de hauteur.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height0.75 m

Plant height max0.89 m

Plant height min0.18 m

Seed mass0.393 mg

Seed mass max0.52 mg

Seed mass min0.27 mg

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max2 000 m

Elevation min300 m

Epiphyteterrestrial

Growth formherb

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry2

Leaf n8.55 mg/g

Photosynthetic pathwayC4

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stipagrostis uniplumis has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes4

GenBank sequences9

eDNA detections7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGQ924139.1 ↗595 bp

ACGT

TCGTGACCCTGACCAAAACAGACCGCGAACGCGTCACCCGTGCCGCCGGGCGCCCCCTAGGGCGGCGCTCGGCCTAGGCCCCCGACCTCC …

Stipagrostis uniplumis voucher Mannheimer 3323 GRA internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★rbcLa★ITS8

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Stipagrostis uniplumis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidypolyploid inferred

Chromosome records44–442n range44median44mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 444×CCDB · book-ipcn65 · CCDB · book-ipcn67-71

CCDB · book-ipcn65 — DeWinter 1965

CCDB · book-ipcn67-71 — DE WINTER, B. 1965. The South African Stipeae and Aristidae (Gramineae). (An anatomical cytological and taxonomic study). Bothalia 8: 201-204.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type497 records

Wild obs. + sensor381

Museum / vouchered104

Cultivated / captive4

Other8

Range

Area of Occupancy AOO1 484 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 86≤1 km 4≤10 km 4

94 georeferenced · 287 without coordinates

Open the mapobservation + sensor381

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 3≤10 km 3

6 georeferenced · 98 without coordinates

Open the institutions mapphysical evidence104

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	35
University of Stellenboschlocation not on record	7
Cape Town, ZA	6
Paris, FR	4
MeiseBGlocation not on record	4
Pretoria, ZA	3
Saint Louis, US	3
QAUlocation not on record	2
Dresden, DE	2
Wlocation not on record	2
South African National Parks, Scientific Services, Kruger National Parklocation not on record	2
GZUlocation not on record	2
Bronx, US	1
Berlin, DE	1
Zürich, CH	1
Durban, ZA	1
University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record	1
South African National Biodiversity Institutelocation not on record	1
Frankfurt am Main	1

19 institutions · 79 of 104 vouchered records shown · 25 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Stipagrostis uniplumis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.6 °C 20.1–28.1

Seasonal swing summer↔winter9.40 °C

Max temp (day)31.2 °C 26.1–32.5

Min temp (night)21.4 °C 14.5–22.7

Precipitation72.7 mm/mo 42.3–98.2

Air humidity55.8 % 54.2–56.4

Moisture balance-81.4 mm/mo -89.6–-70.6

Vapour deficit1,524 Pa 1,094–1,692

Wind speed2.70 m/s 2.10–2.90

Cloud cover39.9 % 19.3–49.3

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)