Stipagrostis sabulicola

(Pilg.) De Winter · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Stipagrostis

At a glance

Occurrence records94

Data sources6

Biological traits16

DNA specimens3

eDNA detections2

Sources6 archives

Databases and archives Stipagrostis sabulicola's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility94 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF94 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Stipagrostis sabulicola là một loài thực vật có hoa trong họ Hòa thảo. Loài này được (Pilg.) De Winter miêu tả khoa học đầu tiên năm 1963.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max2 m

Plant height min1 m

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max800 m

Elevation min100 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC4

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stipagrostis sabulicola has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGQ924134.1 ↗597 bp

ACGT

TCGTGACCCTGACCAAAACAGACCGCGAACGCGTCACCCGTGCCGCCGGGCGCCACCCTAGGGTGGCGCTCGGTCTAGGCCCCCGACCTC …

Stipagrostis sabulicola voucher Mannheimer 3176 GRA internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type94 records

Wild obs. + sensor72

Museum / vouchered22

Range

Area of Occupancy AOO244 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 44≤1 km 11≤10 km 2>10 km 3

60 georeferenced · 12 without coordinates

Open the mapobservation + sensor72

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 22 records without

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	17
Kew, GB	2
Durban, ZA	1
Görlitz, DE	1
South African National Biodiversity Institutelocation not on record	1

5 institutions · 22 of 22 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Stipagrostis sabulicola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.5 °C 24.5–24.5

Seasonal swing summer↔winter8.00 °C

Max temp (day)32.5 °C

Min temp (night)16.1 °C

Precipitation6.90 mm/mo

Air humidity49.3 %

Moisture balance-209 mm/mo

Vapour deficit1,559 Pa

Wind speed3.70 m/s

Cloud cover45.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)