Stipa turkestanica

Hack. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Stipa

At a glance

Occurrence records76

Data sources9

Biological traits17

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Stipa turkestanica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility76 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF76 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 44

01Narrative

Stipa turkestanica is a species of grass that grows in India and Central Asia and western Asia. Its culms are 30–70 cm long, and panicles 8–14 cm long, bearing few spikelets.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height max0.4 m

Plant height min0.25 m

Seed mass4.15 mg

Life cycle & reproduction5

Flowering endJul

Flowering startJun

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatetemperate

Climberself-supporting

Elevation max4 500 m

Elevation min1 400 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTmountains, steppe

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Stipa turkestanica has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences5

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSHE586636.1 ↗308 bp

ACGT

GGAAGGATCATTGTCGTGACCCTGACCAAAACAGACCGCGCACGCGTCACCCATCCCGCCGGCGGCGGCACCGCCCGCCGTCCGGCCAAG …

Stipa turkestanica genomic DNA containing ITS1 and 5.8S rRNA gene

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Stipa turkestanica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 221×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Sheidai, M. & S. Attaei. 2005. Meiotic studies of some Stipa (Poaceae) species and populations in Iran. Cytologia 70: 23–31.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type76 records

Wild obs. + sensor10

Museum / vouchered49

Other17

Range

Area of Occupancy AOO236 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 10

10 georeferenced

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 27>10 km 16

43 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence49

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
GMBAlocation not on record	43
Stockholm, SE	1
Kew, GB	1
CJBGlocation not on record	1
BClocation not on record	1

5 institutions · 47 of 49 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Stipa turkestanica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.20 °C 4.60–7.90

Seasonal swing summer↔winter24.4 °C

Max temp (day)10.9 °C 10.1–11.7

Min temp (night)0.6 °C -2.60–3.80

Precipitation53.4 mm/mo 49.7–57.1

Air humidity57.7 % 52.6–62.7

Moisture balance-27.8 mm/mo -46.8–-8.80

Vapour deficit501 Pa 459–543

Wind speed3.40 m/s 3.10–3.60

Cloud cover33.8 % 27.3–40.3

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)